Rmu_co8347943.1_g000001

Encoded by

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8347943.1
OG0001567
Physical Location & Seq
Forward (+)
1 .. 595
595 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8347943.1_g000001.1.cds

Sequence Viewer

Length: 207 bp
gacggacgggttctgtgttcatcaataccaatttatggacaaagcgaggaagttggagatgaggctggttacattgtaggaatgtccacttgctatccacatccgggctctgtcaaaataaaggatggggagactctgagcacctgccaaagtcctcctcttttagcttggactcttcgctttgaattcaggggtgttatcagctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
SURNod19

Protein Analysis

68

Amino Acids

7.35

Weight (kDa)

4.8

Isoelectric Point (pI)

37.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 152
Acc36I ACCTGC 1 cut(s) 152
AccB7I CCANNNNNTGG 1 cut(s) 35
AcsI RAATTY 1 cut(s) 185
AfiI CCNNNNNNNGG 2 cut(s) 35, 104
AgsI TTSAA 1 cut(s) 185
AluBI AGCT 2 cut(s) 167, 204
AluI AGCT 2 cut(s) 167, 204
Alw21I GWGCWC 1 cut(s) 143
Alw26I GTCTC 1 cut(s) 125
ApoI RAATTY 1 cut(s) 185
AsuC2I CCSGG 1 cut(s) 105
BanII GRGCYC 1 cut(s) 110
Bbv12I GWGCWC 1 cut(s) 143
BccI CCATC 1 cut(s) 119
BcnI CCSGG 1 cut(s) 105
BcoDI GTCTC 1 cut(s) 125
BfuAI ACCTGC 1 cut(s) 152
Bme1390I CCNGG 1 cut(s) 105
BmrFI CCNGG 1 cut(s) 105
BpuMI CCSGG 1 cut(s) 105
Bsc4I CCNNNNNNNGG 2 cut(s) 35, 104
BseGI GGATG 2 cut(s) 100, 130
BseLI CCNNNNNNNGG 2 cut(s) 35, 104
BseMII CTCAG 1 cut(s) 128
BseRI GAGGAG 1 cut(s) 147
BsiHKAI GWGCWC 1 cut(s) 143
BsiSI CCGG 1 cut(s) 104
BslI CCNNNNNNNGG 2 cut(s) 35, 104
BsmAI GTCTC 1 cut(s) 125
Bsp1286I GDGCHC 2 cut(s) 110, 143
BspCNI CTCAG 1 cut(s) 129
BspMI ACCTGC 1 cut(s) 152
Bst6I CTCTTC 1 cut(s) 180
BstDEI CTNAG 1 cut(s) 137
BstF5I GGATG 2 cut(s) 100, 130
BstMAI GTCTC 1 cut(s) 125
BstSCI CCNGG 1 cut(s) 103
BtsCI GGATG 2 cut(s) 100, 130
BveI ACCTGC 1 cut(s) 152
CviJI RGCY 4 cut(s) 65, 108, 167, 204
CviKI_1 RGCY 4 cut(s) 65, 108, 167, 204
DdeI CTNAG 1 cut(s) 137
Eam1104I CTCTTC 1 cut(s) 180
EarI CTCTTC 1 cut(s) 180
Eco24I GRGCYC 1 cut(s) 110
EcoRI GAATTC 1 cut(s) 185
EcoT38I GRGCYC 1 cut(s) 110
FaiI YATR 1 cut(s) 36
FokI GGATG 2 cut(s) 87, 137
FriOI GRGCYC 1 cut(s) 110
HapII CCGG 1 cut(s) 104
HinfI GANTC 2 cut(s) 133, 172
HpaII CCGG 1 cut(s) 104
Hpy166II GTNNAC 1 cut(s) 87
Hpy188I TCNGA 1 cut(s) 138
Hpy8I GTNNAC 1 cut(s) 87
HpyF3I CTNAG 1 cut(s) 137
LpnPI CCDG 4 cut(s) 51, 117, 157, 175
MaeIII GTNAC 1 cut(s) 68
MboII GAAGA 1 cut(s) 167
MhlI GDGCHC 2 cut(s) 110, 143
MluCI AATT 2 cut(s) 30, 185
MlyI GAGTC 2 cut(s) 127, 166
MmeI TCCRAC 1 cut(s) 34
MnlI CCTC 4 cut(s) 40, 55, 165, 168
MspI CCGG 1 cut(s) 104
MspR9I CCNGG 1 cut(s) 105
NciI CCSGG 1 cut(s) 105
PaqCI CACCTGC 1 cut(s) 152
PflMI CCANNNNNTGG 1 cut(s) 35
PleI GAGTC 2 cut(s) 127, 166
PpsI GAGTC 2 cut(s) 127, 166
SchI GAGTC 2 cut(s) 127, 166
ScrFI CCNGG 1 cut(s) 105
SduI GDGCHC 2 cut(s) 110, 143
SetI ASST 3 cut(s) 146, 169, 206
SgeI CNNG 9 cut(s) 20, 58, 78, 102, 116, 117, 156, 180, 202
Sse9I AATT 2 cut(s) 30, 185
StyD4I CCNGG 1 cut(s) 103
TasI AATT 2 cut(s) 30, 185
TspDTI ATGAA 1 cut(s) 9
TspGWI ACGGA 1 cut(s) 18
Van91I CCANNNNNTGG 1 cut(s) 35
XapI RAATTY 1 cut(s) 185
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.