Rmu_co8368305.1_g000001

Encoded by

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8368305.1
OG0001567
Physical Location & Seq
Forward (+)
117 .. 1111
995 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8368305.1_g000001.1.cds

Sequence Viewer

Length: 586 bp
atgaaaattttgactctagctatcatcgtacccactcctctcttgctctggctgaggcacctggaaagaaaatggcacctccttgtcataagtttggtacttttgttagctgtgctagtgctggggttaagcctaccatctccagatgccattcggatcaataaggtcaagaccaggactagtgtttatgtctcccctaagtttgtgttggaaccagggtcagttgcagacaagtatttctataacattcacttcccaagaggtcatattgctatgaagtatttcaatgctgaagtgatcgatgaagaagggaatcctattcctcttcatgagacttatctgcatcattgggttattgaaagatattatgcccaggcaagttatgtggaaccggagctgagtggtttcgaggatattaaagatccggattttaagattgtgagaaatagtggattgtgccagaataatgttcttggtcagtactatggactcgggtcagaaactagaaagacagatacacatgtaccggatccttttggaatagagattggcaaccctgcagagattcctgctggatatgaggaga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
SURNod19

Protein Analysis

195

Amino Acids

22.19

Weight (kDa)

5.9

Isoelectric Point (pI)

40.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 57, 75
AccIII TCCGGA 1 cut(s) 424
AclWI GGATC 4 cut(s) 164, 416, 524, 537
AcsI RAATTY 1 cut(s) 6
AcuI CTGAAG 1 cut(s) 312
AfaI GTAC 4 cut(s) 30, 99, 482, 525
AflIII ACRYGT 1 cut(s) 520
AgsI TTSAA 2 cut(s) 286, 359
AhlI ACTAGT 1 cut(s) 179
AjnI CCWGG 4 cut(s) 60, 173, 214, 372
AluBI AGCT 3 cut(s) 20, 110, 397
AluI AGCT 3 cut(s) 20, 110, 397
Alw26I GTCTC 2 cut(s) 196, 326
AlwI GGATC 4 cut(s) 164, 416, 524, 537
Ama87I CYCGRG 1 cut(s) 491
Aor13HI TCCGGA 1 cut(s) 424
ApoI RAATTY 1 cut(s) 6
Asp700I GAANNNNTTC 1 cut(s) 281
AvaI CYCGRG 1 cut(s) 491
BaeI ACNNNNGTAYC 6 cut(s) 89, 122, 507, 507, 540, 540
BamHI GGATCC 1 cut(s) 529
BanI GGYRCC 2 cut(s) 57, 75
BbvCI CCTCAGC 1 cut(s) 53
BccI CCATC 1 cut(s) 145
BciT130I CCWGG 4 cut(s) 62, 175, 216, 374
BcoDI GTCTC 2 cut(s) 196, 326
BcuI ACTAGT 1 cut(s) 179
BfaI CTAG 4 cut(s) 17, 116, 180, 504
BfmI CTRYAG 1 cut(s) 558
BmcAI AGTACT 1 cut(s) 482
Bme1390I CCNGG 4 cut(s) 62, 175, 216, 374
BmeT110I CYCGRG 1 cut(s) 491
BmiI GGNNCC 5 cut(s) 59, 77, 213, 390, 531
BmrFI CCNGG 4 cut(s) 62, 175, 216, 374
BmsI GCATC 2 cut(s) 136, 352
BoxI GACNNNNGTC 1 cut(s) 493
BpmI CTGGAG 1 cut(s) 126
Bpu10I CCTNAGC 1 cut(s) 53
Bsa29I ATCGAT 1 cut(s) 300
BsaJI CCNNGG 2 cut(s) 215, 372
BsaWI WCCGGW 3 cut(s) 391, 424, 526
BseAI TCCGGA 1 cut(s) 424
BseBI CCWGG 4 cut(s) 62, 175, 216, 374
BseCI ATCGAT 1 cut(s) 300
BseDI CCNNGG 2 cut(s) 215, 372
BseMII CTCAG 2 cut(s) 44, 389
BseRI GAGGAG 1 cut(s) 27
BseYI CCCAGC 1 cut(s) 121
BshNI GGYRCC 2 cut(s) 57, 75
BshVI ATCGAT 1 cut(s) 300
BsiHKCI CYCGRG 1 cut(s) 491
BsiSI CCGG 3 cut(s) 392, 425, 527
BsmAI GTCTC 2 cut(s) 196, 326
BsoBI CYCGRG 1 cut(s) 491
Bsp13I TCCGGA 1 cut(s) 424
Bsp143I GATC 4 cut(s) 156, 297, 421, 529
BspCNI CTCAG 2 cut(s) 45, 390
BspDI ATCGAT 1 cut(s) 300
BspEI TCCGGA 1 cut(s) 424
BspHI TCATGA 1 cut(s) 328
BspLI GGNNCC 5 cut(s) 59, 77, 213, 390, 531
BspMAI CTGCAG 1 cut(s) 562
BspPI GGATC 4 cut(s) 164, 416, 524, 537
BspT107I GGYRCC 2 cut(s) 57, 75
BssECI CCNNGG 2 cut(s) 215, 372
BssMI GATC 4 cut(s) 156, 297, 421, 529
Bst2UI CCWGG 4 cut(s) 62, 175, 216, 374
Bst6I CTCTTC 1 cut(s) 330
BstDEI CTNAG 3 cut(s) 53, 198, 398
BstKTI GATC 4 cut(s) 159, 300, 424, 532
BstMAI GTCTC 2 cut(s) 196, 326
BstMBI GATC 4 cut(s) 156, 297, 421, 529
BstNI CCWGG 4 cut(s) 62, 175, 216, 374
BstNSI RCATGY 1 cut(s) 524
BstPAI GACNNNNGTC 1 cut(s) 493
BstSCI CCNGG 4 cut(s) 60, 173, 214, 372
BstSFI CTRYAG 1 cut(s) 558
BstX2I RGATCY 2 cut(s) 421, 529
BstYI RGATCY 2 cut(s) 421, 529
Bsu15I ATCGAT 1 cut(s) 300
BsuTUI ATCGAT 1 cut(s) 300
CciI TCATGA 1 cut(s) 328
ClaI ATCGAT 1 cut(s) 300
Csp6I GTAC 4 cut(s) 29, 98, 481, 524
CspCI CAANNNNNGTGG 2 cut(s) 366, 401
CviAII CATG 2 cut(s) 329, 521
CviJI RGCY 5 cut(s) 20, 52, 110, 132, 397
CviKI_1 RGCY 5 cut(s) 20, 52, 110, 132, 397
CviQI GTAC 4 cut(s) 29, 98, 481, 524
DdeI CTNAG 3 cut(s) 53, 198, 398
DpnI GATC 4 cut(s) 158, 299, 423, 531
DpnII GATC 4 cut(s) 156, 297, 421, 529
Eam1104I CTCTTC 1 cut(s) 330
EarI CTCTTC 1 cut(s) 330
Eco57I CTGAAG 1 cut(s) 312
Eco88I CYCGRG 1 cut(s) 491
EcoRII CCWGG 4 cut(s) 60, 173, 214, 372
FaeI CATG 2 cut(s) 332, 524
FatI CATG 2 cut(s) 328, 520
FspBI CTAG 4 cut(s) 17, 116, 180, 504
GsaI CCCAGC 1 cut(s) 125
GsuI CTGGAG 1 cut(s) 126
HapII CCGG 3 cut(s) 392, 425, 527
Hin1II CATG 2 cut(s) 332, 524
HinfI GANTC 4 cut(s) 13, 313, 489, 565
HpaII CCGG 3 cut(s) 392, 425, 527
Hpy188I TCNGA 2 cut(s) 156, 499
Hpy188III TCNNGA 4 cut(s) 143, 169, 329, 425
HpyAV CCTTC 1 cut(s) 302
HpyCH4V TGCA 3 cut(s) 227, 343, 560
HpyF3I CTNAG 3 cut(s) 53, 198, 398
Hsp92II CATG 2 cut(s) 332, 524
Kpn2I TCCGGA 1 cut(s) 424
Kzo9I GATC 4 cut(s) 156, 297, 421, 529
LmnI GCTCC 1 cut(s) 394
LweI GCATC 2 cut(s) 136, 352
MaeI CTAG 4 cut(s) 17, 116, 180, 504
MalI GATC 4 cut(s) 158, 299, 423, 531
MboI GATC 4 cut(s) 156, 297, 421, 529
MboII GAAGA 2 cut(s) 317, 317
MflI RGATCY 2 cut(s) 421, 529
MluCI AATT 1 cut(s) 6
MlyI GAGTC 2 cut(s) 7, 483
MmeI TCCRAC 1 cut(s) 189
MnlI CCTC 7 cut(s) 48, 48, 89, 254, 333, 403, 574
MroI TCCGGA 1 cut(s) 424
MroXI GAANNNNTTC 1 cut(s) 281
MseI TTAA 3 cut(s) 128, 417, 432
MspI CCGG 3 cut(s) 392, 425, 527
MspR9I CCNGG 4 cut(s) 62, 175, 216, 374
MvaI CCWGG 4 cut(s) 62, 175, 216, 374
NdeII GATC 4 cut(s) 156, 297, 421, 529
NlaIII CATG 2 cut(s) 332, 524
NlaIV GGNNCC 5 cut(s) 59, 77, 213, 390, 531
NspI RCATGY 1 cut(s) 524
PagI TCATGA 1 cut(s) 328
PciI ACATGT 1 cut(s) 520
PdmI GAANNNNTTC 1 cut(s) 281
PfeI GAWTC 2 cut(s) 313, 565
PleI GAGTC 2 cut(s) 7, 483
PpsI GAGTC 2 cut(s) 7, 483
PscI ACATGT 1 cut(s) 520
PshAI GACNNNNGTC 1 cut(s) 493
Psp6I CCWGG 4 cut(s) 60, 173, 214, 372
PspFI CCCAGC 1 cut(s) 121
PspGI CCWGG 4 cut(s) 60, 173, 214, 372
PspN4I GGNNCC 5 cut(s) 59, 77, 213, 390, 531
PstI CTGCAG 1 cut(s) 562
PsuI RGATCY 2 cut(s) 421, 529
RsaI GTAC 4 cut(s) 30, 99, 482, 525
RsaNI GTAC 4 cut(s) 29, 98, 481, 524
SaqAI TTAA 3 cut(s) 128, 417, 432
Sau3AI GATC 4 cut(s) 156, 297, 421, 529
ScaI AGTACT 1 cut(s) 482
SchI GAGTC 2 cut(s) 7, 483
ScrFI CCNGG 4 cut(s) 62, 175, 216, 374
SetI ASST 7 cut(s) 22, 63, 81, 112, 168, 265, 399
SfaNI GCATC 2 cut(s) 136, 352
SfcI CTRYAG 1 cut(s) 558
SpeI ACTAGT 1 cut(s) 179
Sse9I AATT 1 cut(s) 6
SspMI CTAG 4 cut(s) 17, 116, 180, 504
StyD4I CCNGG 4 cut(s) 60, 173, 214, 372
TaqI TCGA 2 cut(s) 300, 408
TasI AATT 1 cut(s) 6
TatI WGTACW 1 cut(s) 480
TfiI GAWTC 2 cut(s) 313, 565
Tru1I TTAA 3 cut(s) 128, 417, 432
Tru9I TTAA 3 cut(s) 128, 417, 432
TspDTI ATGAA 4 cut(s) 17, 290, 317, 318
XapI RAATTY 1 cut(s) 6
XceI RCATGY 1 cut(s) 524
XmnI GAANNNNTTC 1 cut(s) 281
XspI CTAG 4 cut(s) 17, 116, 180, 504
ZrmI AGTACT 1 cut(s) 482
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.