Rmu_sc0000804.1_g000006

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000804.1
Physical Location & Seq
Reverse (-)
23689 .. 24306
618 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000804.1_g000006.1.cds

Sequence Viewer

Length: 618 bp
atgtattccaaatgtggcaatttgggggccggaaggcaggtattcaagctcatgggtgacaagcaagacactgtgttatggaacacaatgatgtctgccttagcacagcatggtcatggtacagagacattgcagatgtttgaaaacatggtcagtttaagtgtaaagcctgttgcgaccacatttgttgtcattctcaatgcttgtagtcattctggtctagtgcaggaagggcgtaggcttttcaagtccatgactgatgattatggcattgttcctcatgaggaacattatgcatgcttaattgatctcttgggtcgagctggatgttttgatgagttgatgaaccagctcgaaaatatgccatgtaaagctggcggtcaagtttggaatgcattacttagtgtttgtagaatccatggaaatacagagctgggaagaaaagtggctgaacaccttattgagttggagcttcaatcttctgctccctatgttttgctttcgagcatatatgctgaagaaggtagatgggagctggtagagaaggtgagatggcttatggatgagagacatgtgaggaaagagcgagccattagttgggctagaagttcaaagtag

Protein Analysis

205

Amino Acids

23.13

Weight (kDa)

6.45

Isoelectric Point (pI)

52.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 28
AccB7I CCANNNNNTGG 1 cut(s) 597
AciI CCGC 1 cut(s) 378
AcuI CTGAAG 1 cut(s) 537
AfaI GTAC 1 cut(s) 121
AfiI CCNNNNNNNGG 1 cut(s) 597
AflIII ACRYGT 1 cut(s) 571
AgsI TTSAA 5 cut(s) 46, 143, 247, 476, 612
AluBI AGCT 7 cut(s) 49, 323, 352, 374, 433, 472, 535
AluI AGCT 7 cut(s) 49, 323, 352, 374, 433, 472, 535
Alw26I GTCTC 2 cut(s) 119, 562
AoxI GGCC 1 cut(s) 27
AspS9I GGNCC 1 cut(s) 27
AsuHPI GGTGA 2 cut(s) 68, 559
BccI CCATC 2 cut(s) 522, 546
BcoDI GTCTC 2 cut(s) 119, 562
BfaI CTAG 2 cut(s) 221, 603
BfuAI ACCTGC 1 cut(s) 28
BmgT120I GGNCC 1 cut(s) 27
BmiI GGNNCC 1 cut(s) 28
Bpu10I CCTNAGC 1 cut(s) 100
BsaJI CCNNGG 1 cut(s) 418
Bsc4I CCNNNNNNNGG 1 cut(s) 597
Bse3DI GCAATG 1 cut(s) 128
BseDI CCNNGG 1 cut(s) 418
BseGI GGATG 2 cut(s) 332, 568
BseLI CCNNNNNNNGG 1 cut(s) 597
BseMI GCAATG 1 cut(s) 128
BseYI CCCAGC 1 cut(s) 433
BsgI GTGCAG 1 cut(s) 245
BshFI GGCC 1 cut(s) 29
BsiSI CCGG 1 cut(s) 30
BslI CCNNNNNNNGG 1 cut(s) 597
BsmAI GTCTC 2 cut(s) 119, 562
BsmI GAATGC 1 cut(s) 397
BsnI GGCC 1 cut(s) 29
Bsp143I GATC 1 cut(s) 307
Bsp19I CCATGG 1 cut(s) 418
BspACI CCGC 1 cut(s) 378
BspANI GGCC 1 cut(s) 29
BspHI TCATGA 1 cut(s) 280
BspLI GGNNCC 1 cut(s) 28
BspMI ACCTGC 1 cut(s) 28
BsrDI GCAATG 1 cut(s) 128
BssECI CCNNGG 1 cut(s) 418
BssMI GATC 1 cut(s) 307
BssT1I CCWWGG 1 cut(s) 418
Bst4CI ACNGT 1 cut(s) 73
BstC8I GCNNGC 3 cut(s) 298, 376, 588
BstDEI CTNAG 2 cut(s) 100, 401
BstDSI CCRYGG 1 cut(s) 418
BstF5I GGATG 2 cut(s) 332, 568
BstKTI GATC 1 cut(s) 310
BstMAI GTCTC 2 cut(s) 119, 562
BstMBI GATC 1 cut(s) 307
BstMWI GCNNNNNNNGC 1 cut(s) 232
BstNSI RCATGY 2 cut(s) 300, 575
BsuRI GGCC 1 cut(s) 29
BtgI CCRYGG 1 cut(s) 418
BtsCI GGATG 2 cut(s) 332, 568
BtsIMutI CAGTG 1 cut(s) 69
BveI ACCTGC 1 cut(s) 28
Cac8I GCNNGC 3 cut(s) 298, 376, 588
CciI TCATGA 1 cut(s) 280
Cfr13I GGNCC 1 cut(s) 27
Csp6I GTAC 1 cut(s) 120
CspCI CAANNNNNGTGG 2 cut(s) 169, 204
CviQI GTAC 1 cut(s) 120
DdeI CTNAG 2 cut(s) 100, 401
DpnI GATC 1 cut(s) 309
DpnII GATC 1 cut(s) 307
Eco130I CCWWGG 1 cut(s) 418
Eco57I CTGAAG 1 cut(s) 537
EcoT14I CCWWGG 1 cut(s) 418
EcoT22I ATGCAT 2 cut(s) 298, 397
ErhI CCWWGG 1 cut(s) 418
FokI GGATG 2 cut(s) 339, 575
FspBI CTAG 2 cut(s) 221, 603
GsaI CCCAGC 1 cut(s) 437
HaeIII GGCC 1 cut(s) 29
HapII CCGG 1 cut(s) 30
HinfI GANTC 1 cut(s) 414
HpaII CCGG 1 cut(s) 30
HphI GGTGA 2 cut(s) 68, 559
Hpy188III TCNNGA 1 cut(s) 281
HpyAV CCTTC 4 cut(s) 27, 224, 515, 538
HpyCH4III ACNGT 1 cut(s) 73
HpyCH4V TGCA 4 cut(s) 133, 226, 296, 395
HpyF10VI GCNNNNNNNGC 1 cut(s) 232
HpyF3I CTNAG 2 cut(s) 100, 401
Kzo9I GATC 1 cut(s) 307
LmnI GCTCC 3 cut(s) 469, 490, 532
MaeI CTAG 2 cut(s) 221, 603
MaeIII GTNAC 1 cut(s) 56
MalI GATC 1 cut(s) 309
MboI GATC 1 cut(s) 307
MboII GAAGA 3 cut(s) 450, 471, 530
MluCI AATT 2 cut(s) 19, 303
MmeI TCCRAC 1 cut(s) 447
MnlI CCTC 3 cut(s) 277, 288, 570
Mph1103I ATGCAT 2 cut(s) 298, 397
MseI TTAA 2 cut(s) 158, 302
MslI CAYNNNNRTG 2 cut(s) 89, 114
MspI CCGG 1 cut(s) 30
Mva1269I GAATGC 1 cut(s) 397
MwoI GCNNNNNNNGC 1 cut(s) 232
NcoI CCATGG 1 cut(s) 418
NdeII GATC 1 cut(s) 307
NlaIV GGNNCC 1 cut(s) 28
NmuCI GTSAC 1 cut(s) 56
NsiI ATGCAT 2 cut(s) 298, 397
NspI RCATGY 2 cut(s) 300, 575
PaeI GCATGC 1 cut(s) 300
PagI TCATGA 1 cut(s) 280
PciI ACATGT 1 cut(s) 571
PctI GAATGC 1 cut(s) 397
PfeI GAWTC 1 cut(s) 414
PflMI CCANNNNNTGG 1 cut(s) 597
PscI ACATGT 1 cut(s) 571
PspFI CCCAGC 1 cut(s) 433
PspN4I GGNNCC 1 cut(s) 28
PspPI GGNCC 1 cut(s) 27
RsaI GTAC 1 cut(s) 121
RsaNI GTAC 1 cut(s) 120
RseI CAYNNNNRTG 2 cut(s) 89, 114
SaqAI TTAA 2 cut(s) 158, 302
Sau3AI GATC 1 cut(s) 307
Sau96I GGNCC 1 cut(s) 27
SmiMI CAYNNNNRTG 2 cut(s) 89, 114
SphI GCATGC 1 cut(s) 300
Sse9I AATT 2 cut(s) 19, 303
SsiI CCGC 1 cut(s) 378
SspMI CTAG 2 cut(s) 221, 603
StyI CCWWGG 1 cut(s) 418
TaaI ACNGT 1 cut(s) 73
TaqI TCGA 3 cut(s) 319, 354, 503
TasI AATT 2 cut(s) 19, 303
TfiI GAWTC 1 cut(s) 414
Tru1I TTAA 2 cut(s) 158, 302
Tru9I TTAA 2 cut(s) 158, 302
TscAI CASTG 1 cut(s) 76
TseFI GTSAC 1 cut(s) 56
Tsp45I GTSAC 1 cut(s) 56
TspDTI ATGAA 1 cut(s) 359
TspRI CASTG 1 cut(s) 76
Van91I CCANNNNNTGG 1 cut(s) 597
XceI RCATGY 2 cut(s) 300, 575
XspI CTAG 2 cut(s) 221, 603
Zsp2I ATGCAT 2 cut(s) 298, 397
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.