Rorug01G0039500

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Forward (+)
6480988 .. 6486109
5122 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0039500.1

Sequence Viewer

Length: 174 bp
ATGGCATTTGATGGTTGTTGTCCTGATTGTAAGCTCCCTGGGGATGATTGCCCACTAATTTGGGGTGCATGCAATCATGCATTTCATCTTCATTGCATCCTAAAATGGGTAAATTCACAGACTTCTCAAGCACATTGCCCCATGTGCCGGAGGGAGTGGCAGTTCAAAGGATGA

Protein Analysis

57

Amino Acids

6.51

Weight (kDa)

6.86

Isoelectric Point (pI)

35.57

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-ANAPC11 PF12861 1 - 56 4.2e-30 Anaphase-promoting complex subunit 11 RING-H2 finger
zf-rbx1 PF12678 2 - 50 2.8e-18 RING-H2 zinc finger domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 112
AfiI CCNNNNNNNGG 2 cut(s) 106, 147
AgsI TTSAA 1 cut(s) 166
AjnI CCWGG 1 cut(s) 37
AloI GAACNNNNNNTCC 1 cut(s) 146
AluBI AGCT 1 cut(s) 34
AluI AGCT 1 cut(s) 34
ApoI RAATTY 1 cut(s) 112
BccI CCATC 1 cut(s) 5
BciT130I CCWGG 1 cut(s) 39
Bme1390I CCNGG 1 cut(s) 39
BmrFI CCNGG 1 cut(s) 39
BmsI GCATC 1 cut(s) 105
BpuEI CTTGAG 1 cut(s) 111
BsaJI CCNNGG 2 cut(s) 37, 38
BsaXI ACNNNNNCTCC 1 cut(s) 146
Bsc4I CCNNNNNNNGG 2 cut(s) 106, 147
Bse3DI GCAATG 2 cut(s) 91, 133
BseBI CCWGG 1 cut(s) 39
BseDI CCNNGG 2 cut(s) 37, 38
BseGI GGATG 2 cut(s) 49, 96
BseLI CCNNNNNNNGG 2 cut(s) 106, 147
BseMI GCAATG 2 cut(s) 91, 133
BsiSI CCGG 1 cut(s) 148
BslI CCNNNNNNNGG 2 cut(s) 106, 147
BsrDI GCAATG 2 cut(s) 91, 133
BssECI CCNNGG 2 cut(s) 37, 38
Bst2UI CCWGG 1 cut(s) 39
BstC8I GCNNGC 1 cut(s) 70
BstF5I GGATG 2 cut(s) 49, 96
BstMWI GCNNNNNNNGC 1 cut(s) 144
BstNI CCWGG 1 cut(s) 39
BstNSI RCATGY 1 cut(s) 72
BstSCI CCNGG 1 cut(s) 37
BstXI CCANNNNNNTGG 1 cut(s) 60
BtsCI GGATG 2 cut(s) 49, 96
Cac8I GCNNGC 1 cut(s) 70
CviAII CATG 3 cut(s) 69, 77, 142
CviJI RGCY 1 cut(s) 34
CviKI_1 RGCY 1 cut(s) 34
EcoRII CCWGG 1 cut(s) 37
EcoT22I ATGCAT 1 cut(s) 82
FaeI CATG 3 cut(s) 72, 80, 145
FaiI YATR 3 cut(s) 70, 78, 143
FatI CATG 3 cut(s) 68, 76, 141
FokI GGATG 2 cut(s) 56, 83
HapII CCGG 1 cut(s) 148
Hin1II CATG 3 cut(s) 72, 80, 145
HpaII CCGG 1 cut(s) 148
Hpy188III TCNNGA 1 cut(s) 23
HpyCH4V TGCA 4 cut(s) 68, 72, 80, 96
HpyF10VI GCNNNNNNNGC 1 cut(s) 144
Hsp92II CATG 3 cut(s) 72, 80, 145
LmnI GCTCC 1 cut(s) 39
LpnPI CCDG 4 cut(s) 24, 36, 51, 161
LweI GCATC 1 cut(s) 105
MboII GAAGA 1 cut(s) 80
MluCI AATT 2 cut(s) 57, 112
MnlI CCTC 1 cut(s) 144
Mph1103I ATGCAT 1 cut(s) 82
MspI CCGG 1 cut(s) 148
MspR9I CCNGG 1 cut(s) 39
MvaI CCWGG 1 cut(s) 39
MwoI GCNNNNNNNGC 1 cut(s) 144
NlaIII CATG 3 cut(s) 72, 80, 145
NsiI ATGCAT 1 cut(s) 82
NspI RCATGY 1 cut(s) 72
PaeI GCATGC 1 cut(s) 72
PasI CCCWGGG 1 cut(s) 38
Psp6I CCWGG 1 cut(s) 37
PspGI CCWGG 1 cut(s) 37
ScrFI CCNGG 1 cut(s) 39
SetI ASST 1 cut(s) 36
SfaNI GCATC 1 cut(s) 105
SgeI CNNG 8 cut(s) 35, 50, 51, 81, 89, 140, 154, 160
SmlI CTYRAG 1 cut(s) 126
SmoI CTYRAG 1 cut(s) 126
SphI GCATGC 1 cut(s) 72
Sse9I AATT 2 cut(s) 57, 112
StyD4I CCNGG 1 cut(s) 37
TasI AATT 2 cut(s) 57, 112
TspDTI ATGAA 2 cut(s) 74, 80
XapI RAATTY 1 cut(s) 112
XceI RCATGY 1 cut(s) 72
Zsp2I ATGCAT 1 cut(s) 82
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.