Rmu_sc0002634.1_g000019

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002634.1
Physical Location & Seq
Forward (+)
98410 .. 99230
821 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002634.1_g000019.1.cds

Sequence Viewer

Length: 747 bp
atgaggagtctgaaggaggcccggaacttgtttgagcaaatgcctgagagggatgttgtgttctggaacaccgtggtgattggttatgcccagaatggggaatgtgataaggctttgaggttttatagagagttgcggagatcgtcggcaagctcatgggcaagtttggttgcttgggttttgtcaaatgtggtactttcgagttcggtggtggatgtttatgccaagtgtggggagatggcggatgctaggagattgttcgatgagatggctgtgagggatgttcttgcttggaccacactggtttcgggatatgccaaatggggtgatatgaaatcagctagtgagttgtttgattggatgcctgagaagaacccggtgtcatgggcatctatgatttcggggtatgttaggaatggattggggcatgaagcgcttgcattgtttgcagagatgatgctgtttcaaatcaggcctgatcagtttacctttagtagttgcctttgtgcttgtgctggtatagcttcttttaagcatggtaaacaaattcatgcctctttagtacgaagtaatttaagacccaacacgattgttgtgagttctcttatcgacatgtattccaaatgggggaatttgggggccagaaggcaggtattcaagctcatgggtgatatgcaagacaccgtgttatggaacacaatgatgtctgacttagcacaacatggtcatagtatagaggcattatag

Protein Analysis

248

Amino Acids

27.99

Weight (kDa)

7.66

Isoelectric Point (pI)

46.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 640
AciI CCGC 2 cut(s) 136, 242
AcsI RAATTY 2 cut(s) 546, 631
AcuI CTGAAG 1 cut(s) 32
AfaI GTAC 2 cut(s) 195, 564
AfeI AGCGCT 1 cut(s) 435
AfiI CCNNNNNNNGG 5 cut(s) 96, 97, 231, 627, 690
AflIII ACRYGT 1 cut(s) 612
AgsI TTSAA 2 cut(s) 467, 658
AleI CACNNNNGTG 1 cut(s) 74
AloI GAACNNNNNNTCC 2 cut(s) 44, 76
AluBI AGCT 4 cut(s) 153, 341, 524, 661
AluI AGCT 4 cut(s) 153, 341, 524, 661
Aor51HI AGCGCT 1 cut(s) 435
AoxI GGCC 3 cut(s) 18, 473, 639
ApoI RAATTY 2 cut(s) 546, 631
AspLEI GCGC 1 cut(s) 436
AspS9I GGNCC 3 cut(s) 19, 294, 639
AsuC2I CCSGG 2 cut(s) 22, 377
AsuHPI GGTGA 3 cut(s) 88, 338, 680
AvaII GGWCC 1 cut(s) 294
BccI CCATC 2 cut(s) 232, 262
BclI TGATCA 1 cut(s) 478
BcnI CCSGG 2 cut(s) 22, 377
BfaI CTAG 2 cut(s) 249, 342
BfoI RGCGCY 1 cut(s) 437
BfuAI ACCTGC 1 cut(s) 640
Bme1390I CCNGG 2 cut(s) 22, 377
Bme18I GGWCC 1 cut(s) 294
BmgT120I GGNCC 3 cut(s) 19, 294, 639
BmiI GGNNCC 1 cut(s) 640
BmrFI CCNGG 2 cut(s) 22, 377
BmsI GCATC 4 cut(s) 235, 351, 398, 447
BpuMI CCSGG 2 cut(s) 22, 377
BsaJI CCNNGG 1 cut(s) 72
Bsc4I CCNNNNNNNGG 5 cut(s) 96, 97, 231, 627, 690
Bse1I ACTGG 1 cut(s) 306
BseDI CCNNGG 1 cut(s) 72
BseGI GGATG 5 cut(s) 58, 220, 250, 286, 366
BseLI CCNNNNNNNGG 5 cut(s) 96, 97, 231, 627, 690
BseMII CTCAG 2 cut(s) 36, 357
BseNI ACTGG 1 cut(s) 306
BseRI GAGGAG 1 cut(s) 19
BshFI GGCC 3 cut(s) 20, 475, 641
BsiSI CCGG 2 cut(s) 22, 377
BslI CCNNNNNNNGG 5 cut(s) 96, 97, 231, 627, 690
BsnI GGCC 3 cut(s) 20, 475, 641
Bsp143I GATC 2 cut(s) 140, 478
BspACI CCGC 2 cut(s) 136, 242
BspANI GGCC 3 cut(s) 20, 475, 641
BspCNI CTCAG 2 cut(s) 37, 358
BspLI GGNNCC 1 cut(s) 640
BspMI ACCTGC 1 cut(s) 640
BsrI ACTGG 1 cut(s) 306
BssECI CCNNGG 1 cut(s) 72
BssMI GATC 2 cut(s) 140, 478
Bst4CI ACNGT 2 cut(s) 73, 685
BstAPI GCANNNNNTGC 1 cut(s) 446
BstC8I GCNNGC 2 cut(s) 151, 438
BstDEI CTNAG 3 cut(s) 45, 366, 712
BstDSI CCRYGG 1 cut(s) 72
BstF5I GGATG 5 cut(s) 58, 220, 250, 286, 366
BstH2I RGCGCY 1 cut(s) 437
BstHHI GCGC 1 cut(s) 436
BstKTI GATC 2 cut(s) 143, 481
BstMBI GATC 2 cut(s) 140, 478
BstMWI GCNNNNNNNGC 3 cut(s) 433, 446, 521
BstNSI RCATGY 1 cut(s) 616
BstSCI CCNGG 2 cut(s) 20, 375
BsuRI GGCC 3 cut(s) 20, 475, 641
BtgI CCRYGG 1 cut(s) 72
BtsCI GGATG 5 cut(s) 58, 220, 250, 286, 366
BtsIMutI CAGTG 1 cut(s) 299
BveI ACCTGC 1 cut(s) 640
Cac8I GCNNGC 2 cut(s) 151, 438
CfoI GCGC 1 cut(s) 436
Cfr13I GGNCC 3 cut(s) 19, 294, 639
Csp6I GTAC 2 cut(s) 194, 563
CviAII CATG 8 cut(s) 156, 384, 428, 536, 551, 613, 664, 722
CviJI RGCY 9 cut(s) 20, 113, 153, 272, 341, 475, 524, 641, 661
CviKI_1 RGCY 9 cut(s) 20, 113, 153, 272, 341, 475, 524, 641, 661
CviQI GTAC 2 cut(s) 194, 563
DdeI CTNAG 3 cut(s) 45, 366, 712
DpnI GATC 2 cut(s) 142, 480
DpnII GATC 2 cut(s) 140, 478
EciI GGCGGA 1 cut(s) 257
Eco147I AGGCCT 1 cut(s) 475
Eco47I GGWCC 1 cut(s) 294
Eco47III AGCGCT 1 cut(s) 435
Eco57I CTGAAG 1 cut(s) 32
FaeI CATG 8 cut(s) 159, 387, 431, 539, 554, 616, 667, 725
FatI CATG 8 cut(s) 155, 383, 427, 535, 550, 612, 663, 721
FbaI TGATCA 1 cut(s) 478
FokI GGATG 5 cut(s) 65, 227, 257, 293, 373
FspBI CTAG 2 cut(s) 249, 342
GlaI GCGC 1 cut(s) 435
HaeII RGCGCY 1 cut(s) 437
HaeIII GGCC 3 cut(s) 20, 475, 641
HapII CCGG 2 cut(s) 22, 377
HhaI GCGC 1 cut(s) 436
Hin1II CATG 8 cut(s) 159, 387, 431, 539, 554, 616, 667, 725
Hin6I GCGC 1 cut(s) 434
HinP1I GCGC 1 cut(s) 434
HinfI GANTC 1 cut(s) 7
HpaII CCGG 2 cut(s) 22, 377
HphI GGTGA 3 cut(s) 88, 338, 680
Hpy166II GTNNAC 2 cut(s) 486, 542
Hpy188I TCNGA 2 cut(s) 12, 709
Hpy188III TCNNGA 2 cut(s) 64, 309
Hpy8I GTNNAC 2 cut(s) 486, 542
Hpy99I CGWCG 1 cut(s) 148
HpyAV CCTTC 2 cut(s) 7, 639
HpyCH4III ACNGT 2 cut(s) 73, 685
HpyCH4V TGCA 3 cut(s) 440, 449, 676
HpyF10VI GCNNNNNNNGC 3 cut(s) 433, 446, 521
HpyF3I CTNAG 3 cut(s) 45, 366, 712
Hsp92II CATG 8 cut(s) 159, 387, 431, 539, 554, 616, 667, 725
HspAI GCGC 1 cut(s) 434
Ksp22I TGATCA 1 cut(s) 478
Kzo9I GATC 2 cut(s) 140, 478
LweI GCATC 4 cut(s) 235, 351, 398, 447
MaeI CTAG 2 cut(s) 249, 342
MalI GATC 2 cut(s) 142, 480
MboI GATC 2 cut(s) 140, 478
MboII GAAGA 1 cut(s) 382
MluCI AATT 3 cut(s) 546, 571, 631
MlyI GAGTC 1 cut(s) 16
MnlI CCTC 6 cut(s) 10, 42, 111, 270, 565, 730
MseI TTAA 2 cut(s) 531, 575
MslI CAYNNNNRTG 2 cut(s) 74, 701
MspI CCGG 2 cut(s) 22, 377
MspR9I CCNGG 2 cut(s) 22, 377
MwoI GCNNNNNNNGC 3 cut(s) 433, 446, 521
NciI CCSGG 2 cut(s) 22, 377
NdeII GATC 2 cut(s) 140, 478
NlaIII CATG 8 cut(s) 159, 387, 431, 539, 554, 616, 667, 725
NlaIV GGNNCC 1 cut(s) 640
NspI RCATGY 1 cut(s) 616
OliI CACNNNNGTG 1 cut(s) 74
PceI AGGCCT 1 cut(s) 475
PciI ACATGT 1 cut(s) 612
PleI GAGTC 1 cut(s) 15
PpsI GAGTC 1 cut(s) 15
PscI ACATGT 1 cut(s) 612
PspN4I GGNNCC 1 cut(s) 640
PspPI GGNCC 3 cut(s) 19, 294, 639
RsaI GTAC 2 cut(s) 195, 564
RsaNI GTAC 2 cut(s) 194, 563
RseI CAYNNNNRTG 2 cut(s) 74, 701
SaqAI TTAA 2 cut(s) 531, 575
Sau3AI GATC 2 cut(s) 140, 478
Sau96I GGNCC 3 cut(s) 19, 294, 639
SchI GAGTC 1 cut(s) 16
ScrFI CCNGG 2 cut(s) 22, 377
SetI ASST 7 cut(s) 122, 155, 343, 491, 526, 654, 663
SfaNI GCATC 4 cut(s) 235, 351, 398, 447
SinI GGWCC 1 cut(s) 294
SmiMI CAYNNNNRTG 2 cut(s) 74, 701
Sse9I AATT 3 cut(s) 546, 571, 631
SseBI AGGCCT 1 cut(s) 475
SsiI CCGC 2 cut(s) 136, 242
SspMI CTAG 2 cut(s) 249, 342
StuI AGGCCT 1 cut(s) 475
StyD4I CCNGG 2 cut(s) 20, 375
TaaI ACNGT 2 cut(s) 73, 685
TaqI TCGA 3 cut(s) 200, 261, 609
TasI AATT 3 cut(s) 546, 571, 631
Tru1I TTAA 2 cut(s) 531, 575
Tru9I TTAA 2 cut(s) 531, 575
TscAI CASTG 1 cut(s) 306
TspDTI ATGAA 3 cut(s) 347, 444, 539
TspRI CASTG 1 cut(s) 306
VpaK11BI GGWCC 1 cut(s) 294
XapI RAATTY 2 cut(s) 546, 631
XceI RCATGY 1 cut(s) 616
XspI CTAG 2 cut(s) 249, 342
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.