Rmu_sc0008902.1_g000002

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008902.1
Physical Location & Seq
Forward (+)
2844 .. 3836
993 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008902.1_g000002.1.cds

Sequence Viewer

Length: 993 bp
atggcagatgccaggagattgttctatgagatgactgtgagggatgttcttgcttggaccacactggtttcgagatatgccaaatggggtgatatgaaatcagctagtgagttgtttgatcggatgcctgagaagaacccggtgtcgtggacatcaatgatttcggggtatgctaggaatggattggggcatgaagtgcttgcattgtttgcagagatgatgctgtttcaagtcaggcctgatcagtttacctttagtagttgcctttgtgcttgtgctagtatagcttcgcttaagcatggcaaacaaattcatgcctttttagtaagaagtaatttaagacccaacacgattgttgtgagttctcttatcgacatgtattccaaatgtggcaatttgggggccggaaggcaggtattcaagctcacgggtgacaagcaagacactgtgttatggaacacaatgatgtctgccttagcacagcatggacatggtacagagacattgcagatgtttgaaaacatggtcagttcaggtgtaaagccggttacgaccacatttgttgtcattctcaatgcttgtagtcattctggtctagtgcaggaagggcgttggcttttcaagtccatgactgatgattatggcattgttcctcatgaggaacattatgcatgcttaattgatctcttgggtcgagctggatgttttgatgagttgatgaaccagctagaaaatatgccatgtaaagctggcggtcaagtttggaatgcattacttggtgtttgtagaatccatggaaatacagagctgggaagaaaagtggctgaacaccttattgagttggagcctcaaccttctgctccctatgttttgctttcgagcatatatgctgaagaaggtagatgggagctggtagagaaggtgagatggcttatggatgagagacatgtgaggaaagagcgagccattagttgggctagaagttcaaagtag

Protein Analysis

330

Amino Acids

37.2

Weight (kDa)

7.15

Isoelectric Point (pI)

48.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 403
AccB7I CCANNNNNTGG 1 cut(s) 972
AciI CCGC 1 cut(s) 753
AcsI RAATTY 1 cut(s) 309
AcuI CTGAAG 1 cut(s) 912
AfaI GTAC 1 cut(s) 496
AfiI CCNNNNNNNGG 1 cut(s) 972
AflII CTTAAG 1 cut(s) 293
AflIII ACRYGT 2 cut(s) 375, 946
AgsI TTSAA 5 cut(s) 230, 421, 518, 622, 987
AjnI CCWGG 1 cut(s) 11
AluBI AGCT 8 cut(s) 104, 287, 424, 698, 727, 749, 808, 910
AluI AGCT 8 cut(s) 104, 287, 424, 698, 727, 749, 808, 910
Alw26I GTCTC 2 cut(s) 494, 937
AoxI GGCC 2 cut(s) 236, 402
ApoI RAATTY 1 cut(s) 309
AspS9I GGNCC 2 cut(s) 57, 402
AsuC2I CCSGG 1 cut(s) 140
AsuHPI GGTGA 3 cut(s) 101, 443, 934
AvaII GGWCC 1 cut(s) 57
BccI CCATC 2 cut(s) 897, 921
BciT130I CCWGG 1 cut(s) 13
BclI TGATCA 1 cut(s) 241
BcnI CCSGG 1 cut(s) 140
BcoDI GTCTC 2 cut(s) 494, 937
BfaI CTAG 6 cut(s) 105, 174, 279, 596, 728, 978
BfrI CTTAAG 1 cut(s) 293
BfuAI ACCTGC 1 cut(s) 403
Bme1390I CCNGG 2 cut(s) 13, 140
Bme18I GGWCC 1 cut(s) 57
BmgT120I GGNCC 2 cut(s) 57, 402
BmiI GGNNCC 2 cut(s) 403, 846
BmrFI CCNGG 2 cut(s) 13, 140
BmsI GCATC 2 cut(s) 114, 210
Bpu10I CCTNAGC 1 cut(s) 475
BpuMI CCSGG 1 cut(s) 140
BsaJI CCNNGG 1 cut(s) 793
Bsc4I CCNNNNNNNGG 1 cut(s) 972
Bse118I RCCGGY 1 cut(s) 544
Bse1I ACTGG 1 cut(s) 69
Bse3DI GCAATG 1 cut(s) 503
BseBI CCWGG 1 cut(s) 13
BseDI CCNNGG 1 cut(s) 793
BseGI GGATG 4 cut(s) 49, 129, 707, 943
BseLI CCNNNNNNNGG 1 cut(s) 972
BseMI GCAATG 1 cut(s) 503
BseMII CTCAG 1 cut(s) 120
BseNI ACTGG 1 cut(s) 69
BseYI CCCAGC 1 cut(s) 808
BsgI GTGCAG 1 cut(s) 620
BshFI GGCC 2 cut(s) 238, 404
BsiSI CCGG 3 cut(s) 140, 405, 545
BslI CCNNNNNNNGG 1 cut(s) 972
BsmAI GTCTC 2 cut(s) 494, 937
BsmI GAATGC 1 cut(s) 772
BsnI GGCC 2 cut(s) 238, 404
Bsp143I GATC 3 cut(s) 118, 241, 682
Bsp19I CCATGG 1 cut(s) 793
BspACI CCGC 1 cut(s) 753
BspANI GGCC 2 cut(s) 238, 404
BspCNI CTCAG 1 cut(s) 121
BspHI TCATGA 1 cut(s) 655
BspLI GGNNCC 2 cut(s) 403, 846
BspMI ACCTGC 1 cut(s) 403
BspTI CTTAAG 1 cut(s) 293
BsrDI GCAATG 1 cut(s) 503
BsrFI RCCGGY 1 cut(s) 544
BsrI ACTGG 1 cut(s) 69
BssAI RCCGGY 1 cut(s) 544
BssECI CCNNGG 1 cut(s) 793
BssMI GATC 3 cut(s) 118, 241, 682
BssT1I CCWWGG 1 cut(s) 793
Bst2UI CCWGG 1 cut(s) 13
Bst4CI ACNGT 2 cut(s) 37, 448
BstAFI CTTAAG 1 cut(s) 293
BstAPI GCANNNNNTGC 2 cut(s) 196, 209
BstC8I GCNNGC 4 cut(s) 201, 673, 751, 963
BstDEI CTNAG 2 cut(s) 129, 475
BstDSI CCRYGG 1 cut(s) 793
BstF5I GGATG 4 cut(s) 49, 129, 707, 943
BstKTI GATC 3 cut(s) 121, 244, 685
BstMAI GTCTC 2 cut(s) 494, 937
BstMBI GATC 3 cut(s) 118, 241, 682
BstMWI GCNNNNNNNGC 4 cut(s) 196, 209, 284, 607
BstNI CCWGG 1 cut(s) 13
BstNSI RCATGY 3 cut(s) 379, 675, 950
BstSCI CCNGG 2 cut(s) 11, 138
BsuRI GGCC 2 cut(s) 238, 404
BtgI CCRYGG 1 cut(s) 793
BtsCI GGATG 4 cut(s) 49, 129, 707, 943
BtsIMutI CAGTG 2 cut(s) 62, 444
BveI ACCTGC 1 cut(s) 403
Cac8I GCNNGC 4 cut(s) 201, 673, 751, 963
CciI TCATGA 1 cut(s) 655
Cfr10I RCCGGY 1 cut(s) 544
Cfr13I GGNCC 2 cut(s) 57, 402
Csp6I GTAC 1 cut(s) 495
CspCI CAANNNNNGTGG 2 cut(s) 544, 579
CviQI GTAC 1 cut(s) 495
DdeI CTNAG 2 cut(s) 129, 475
DpnI GATC 3 cut(s) 120, 243, 684
DpnII GATC 3 cut(s) 118, 241, 682
Eco130I CCWWGG 1 cut(s) 793
Eco147I AGGCCT 1 cut(s) 238
Eco47I GGWCC 1 cut(s) 57
Eco57I CTGAAG 1 cut(s) 912
EcoRII CCWGG 1 cut(s) 11
EcoT14I CCWWGG 1 cut(s) 793
EcoT22I ATGCAT 2 cut(s) 673, 772
ErhI CCWWGG 1 cut(s) 793
FbaI TGATCA 1 cut(s) 241
FokI GGATG 4 cut(s) 56, 136, 714, 950
FspBI CTAG 6 cut(s) 105, 174, 279, 596, 728, 978
GsaI CCCAGC 1 cut(s) 812
HaeIII GGCC 2 cut(s) 238, 404
HapII CCGG 3 cut(s) 140, 405, 545
HinfI GANTC 1 cut(s) 789
HpaII CCGG 3 cut(s) 140, 405, 545
HphI GGTGA 3 cut(s) 101, 443, 934
Hpy166II GTNNAC 2 cut(s) 150, 249
Hpy188I TCNGA 1 cut(s) 123
Hpy188III TCNNGA 2 cut(s) 72, 656
Hpy8I GTNNAC 2 cut(s) 150, 249
HpyAV CCTTC 5 cut(s) 402, 599, 864, 890, 913
HpyCH4III ACNGT 2 cut(s) 37, 448
HpyCH4V TGCA 6 cut(s) 203, 212, 508, 601, 671, 770
HpyF10VI GCNNNNNNNGC 4 cut(s) 196, 209, 284, 607
HpyF3I CTNAG 2 cut(s) 129, 475
Ksp22I TGATCA 1 cut(s) 241
Kzo9I GATC 3 cut(s) 118, 241, 682
LmnI GCTCC 3 cut(s) 844, 865, 907
LweI GCATC 2 cut(s) 114, 210
MaeI CTAG 6 cut(s) 105, 174, 279, 596, 728, 978
MaeIII GTNAC 2 cut(s) 431, 547
MalI GATC 3 cut(s) 120, 243, 684
MboI GATC 3 cut(s) 118, 241, 682
MboII GAAGA 3 cut(s) 145, 825, 905
MluCI AATT 4 cut(s) 309, 334, 394, 678
MmeI TCCRAC 1 cut(s) 822
MnlI CCTC 5 cut(s) 33, 652, 663, 858, 945
Mph1103I ATGCAT 2 cut(s) 673, 772
MseI TTAA 3 cut(s) 294, 338, 677
MslI CAYNNNNRTG 2 cut(s) 464, 489
MspCI CTTAAG 1 cut(s) 293
MspI CCGG 3 cut(s) 140, 405, 545
MspR9I CCNGG 2 cut(s) 13, 140
Mva1269I GAATGC 1 cut(s) 772
MvaI CCWGG 1 cut(s) 13
MwoI GCNNNNNNNGC 4 cut(s) 196, 209, 284, 607
NciI CCSGG 1 cut(s) 140
NcoI CCATGG 1 cut(s) 793
NdeII GATC 3 cut(s) 118, 241, 682
NlaIV GGNNCC 2 cut(s) 403, 846
NmuCI GTSAC 1 cut(s) 431
NsiI ATGCAT 2 cut(s) 673, 772
NspI RCATGY 3 cut(s) 379, 675, 950
PaeI GCATGC 1 cut(s) 675
PagI TCATGA 1 cut(s) 655
PceI AGGCCT 1 cut(s) 238
PciI ACATGT 2 cut(s) 375, 946
PctI GAATGC 1 cut(s) 772
PfeI GAWTC 1 cut(s) 789
PflMI CCANNNNNTGG 1 cut(s) 972
PscI ACATGT 2 cut(s) 375, 946
Psp6I CCWGG 1 cut(s) 11
PspFI CCCAGC 1 cut(s) 808
PspGI CCWGG 1 cut(s) 11
PspN4I GGNNCC 2 cut(s) 403, 846
PspPI GGNCC 2 cut(s) 57, 402
RsaI GTAC 1 cut(s) 496
RsaNI GTAC 1 cut(s) 495
RseI CAYNNNNRTG 2 cut(s) 464, 489
SaqAI TTAA 3 cut(s) 294, 338, 677
Sau3AI GATC 3 cut(s) 118, 241, 682
Sau96I GGNCC 2 cut(s) 57, 402
ScrFI CCNGG 2 cut(s) 13, 140
SfaNI GCATC 2 cut(s) 114, 210
SinI GGWCC 1 cut(s) 57
SmiMI CAYNNNNRTG 2 cut(s) 464, 489
SmlI CTYRAG 1 cut(s) 293
SmoI CTYRAG 1 cut(s) 293
SphI GCATGC 1 cut(s) 675
Sse9I AATT 4 cut(s) 309, 334, 394, 678
SseBI AGGCCT 1 cut(s) 238
SsiI CCGC 1 cut(s) 753
SspMI CTAG 6 cut(s) 105, 174, 279, 596, 728, 978
StuI AGGCCT 1 cut(s) 238
StyD4I CCNGG 2 cut(s) 11, 138
StyI CCWWGG 1 cut(s) 793
TaaI ACNGT 2 cut(s) 37, 448
TaqI TCGA 4 cut(s) 71, 372, 694, 878
TasI AATT 4 cut(s) 309, 334, 394, 678
TfiI GAWTC 1 cut(s) 789
Tru1I TTAA 3 cut(s) 294, 338, 677
Tru9I TTAA 3 cut(s) 294, 338, 677
TscAI CASTG 2 cut(s) 69, 451
TseFI GTSAC 1 cut(s) 431
Tsp45I GTSAC 1 cut(s) 431
TspDTI ATGAA 4 cut(s) 110, 207, 302, 734
TspRI CASTG 2 cut(s) 69, 451
Van91I CCANNNNNTGG 1 cut(s) 972
Vha464I CTTAAG 1 cut(s) 293
VpaK11BI GGWCC 1 cut(s) 57
XapI RAATTY 1 cut(s) 309
XceI RCATGY 3 cut(s) 379, 675, 950
XspI CTAG 6 cut(s) 105, 174, 279, 596, 728, 978
Zsp2I ATGCAT 2 cut(s) 673, 772
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.