Rmu_sc0000909.1_g000023

WD repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000909.1
OG0001622
Physical Location & Seq
Forward (+)
87029 .. 89224
2196 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000909.1_g000023.1.cds

Sequence Viewer

Length: 972 bp
atgtatagttacttactggctaaagtttccgcatatgttgtgaatcctttgcgtaacttggtctgggctacatcaaagcatgatgtctaccttctgtcacatttttctgtcattcattggtcttcattaagttgcgaagcatctgaggttctaaatgtttcaggacatgtcacaccatcagagaaacatcctggaagtctattggagggacttacacagactcaagttagtagtcttgcagtgaaagataagttgctagtttctggaggattccaaggagaacttatttgcaagcatcttgatcaacctggagttagcttttgttcgaggacaactgatgatgataatgccattacaaatgctattgagatttatgacaatcccagtggtgcagctcactttacagcctcaagtaatgattgtggagtcagagactttgacatggagacatttcagctttctaagcatttccgttttccttggccacatacttctctgagtcccgatggtaaacttcttgtgatagttggtgacaatccagatgggatgttggtcgactctcaaactgggaaggtgacggtgatgtctttatgtggacacttggatttctcgtttgcatcagcgtggcatcctgatggtgtcacctttgctactgggaaccaggataagacctgtcgggtttgggatgttcgaaacctatccaagtcagttgctgttttaaagggaaaccttggagctattcggtcaatccgttatacttctgatggtcagtatatgatgatggcagagccagcagactttgtgcatgtctatgatgtgaaaagtgggtacgagaaggagcaggaaatcgatttctttggagagatatctggcatatcattcagtccagacacagagtcgcttttcattggagtatgggatcgtacatatggtagtcttctcgagtatggaagacaaaagtgtgttgcttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF2415 WD40

Protein Analysis

323

Amino Acids

35.59

Weight (kDa)

5.29

Isoelectric Point (pI)

23.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 583
AccI GTMKAC 2 cut(s) 87, 555
AciI CCGC 1 cut(s) 30
AclWI GGATC 1 cut(s) 927
AcoI YGGCCR 1 cut(s) 482
AfaI GTAC 2 cut(s) 830, 925
AflIII ACRYGT 1 cut(s) 166
AhdI GACNNNNNGTC 1 cut(s) 895
AjnI CCWGG 3 cut(s) 190, 307, 660
AluBI AGCT 4 cut(s) 318, 395, 457, 737
AluI AGCT 4 cut(s) 318, 395, 457, 737
Alw26I GTCTC 2 cut(s) 426, 440
AlwI GGATC 1 cut(s) 927
AlwNI CAGNNNCTG 1 cut(s) 713
Ama87I CYCGRG 1 cut(s) 941
AoxI GGCC 1 cut(s) 482
ApeKI GCWGC 1 cut(s) 392
AsuHPI GGTGA 4 cut(s) 542, 586, 592, 634
AsuII TTCGAA 1 cut(s) 691
AvaI CYCGRG 1 cut(s) 941
BalI TGGCCA 1 cut(s) 484
BbsI GAAGAC 3 cut(s) 114, 929, 958
BbvI GCAGC 1 cut(s) 404
BccI CCATC 6 cut(s) 184, 500, 536, 629, 758, 775
BciT130I CCWGG 3 cut(s) 192, 309, 662
BclI TGATCA 1 cut(s) 301
BcoDI GTCTC 2 cut(s) 426, 440
BfaI CTAG 1 cut(s) 257
BisI GCNGC 1 cut(s) 393
BlsI GCNGC 1 cut(s) 394
Bme1390I CCNGG 3 cut(s) 192, 309, 662
BmeRI GACNNNNNGTC 1 cut(s) 895
BmeT110I CYCGRG 1 cut(s) 941
BmiI GGNNCC 1 cut(s) 659
BmrFI CCNGG 3 cut(s) 192, 309, 662
BmrI ACTGGG 3 cut(s) 378, 576, 663
BmsI GCATC 4 cut(s) 149, 304, 626, 637
BmuI ACTGGG 3 cut(s) 378, 576, 663
BpiI GAAGAC 3 cut(s) 114, 929, 958
BpmI CTGGAG 2 cut(s) 285, 330
Bpu14I TTCGAA 1 cut(s) 691
BpuEI CTTGAG 2 cut(s) 207, 394
Bsa29I ATCGAT 1 cut(s) 849
BsaJI CCNNGG 3 cut(s) 274, 479, 730
Bse1I ACTGG 4 cut(s) 21, 384, 571, 658
BseBI CCWGG 3 cut(s) 192, 309, 662
BseCI ATCGAT 1 cut(s) 849
BseDI CCNNGG 3 cut(s) 274, 479, 730
BseGI GGATG 4 cut(s) 187, 552, 628, 691
BseMII CTCAG 2 cut(s) 135, 488
BseNI ACTGG 4 cut(s) 21, 384, 571, 658
BseXI GCAGC 1 cut(s) 404
BsgI GTGCAG 1 cut(s) 411
BshFI GGCC 1 cut(s) 484
BshVI ATCGAT 1 cut(s) 849
BsiHKCI CYCGRG 1 cut(s) 941
BslFI GGGAC 2 cut(s) 222, 486
BsmAI GTCTC 2 cut(s) 426, 440
BsmFI GGGAC 2 cut(s) 222, 486
BsnI GGCC 1 cut(s) 484
BsoBI CYCGRG 1 cut(s) 941
Bsp119I TTCGAA 1 cut(s) 691
Bsp143I GATC 2 cut(s) 301, 919
BspACI CCGC 1 cut(s) 30
BspANI GGCC 1 cut(s) 484
BspCNI CTCAG 2 cut(s) 136, 489
BspDI ATCGAT 1 cut(s) 849
BspLI GGNNCC 1 cut(s) 659
BspPI GGATC 1 cut(s) 927
BspT104I TTCGAA 1 cut(s) 691
BsrI ACTGG 4 cut(s) 21, 384, 571, 658
BssECI CCNNGG 3 cut(s) 274, 479, 730
BssMI GATC 2 cut(s) 301, 919
BssT1I CCWWGG 3 cut(s) 274, 479, 730
Bst2UI CCWGG 3 cut(s) 192, 309, 662
Bst4CI ACNGT 1 cut(s) 580
BstBI TTCGAA 1 cut(s) 691
BstC8I GCNNGC 2 cut(s) 293, 792
BstDEI CTNAG 3 cut(s) 144, 462, 497
BstF5I GGATG 4 cut(s) 187, 552, 628, 691
BstKTI GATC 2 cut(s) 304, 922
BstMAI GTCTC 2 cut(s) 426, 440
BstMBI GATC 2 cut(s) 301, 919
BstMWI GCNNNNNNNGC 2 cut(s) 463, 791
BstNI CCWGG 3 cut(s) 192, 309, 662
BstNSI RCATGY 2 cut(s) 170, 809
BstSCI CCNGG 3 cut(s) 190, 307, 660
BstV1I GCAGC 1 cut(s) 404
BstV2I GAAGAC 3 cut(s) 114, 929, 958
Bsu15I ATCGAT 1 cut(s) 849
BsuRI GGCC 1 cut(s) 484
BsuTUI ATCGAT 1 cut(s) 849
BtsCI GGATG 4 cut(s) 187, 552, 628, 691
BtsI GCAGTG 1 cut(s) 246
BtsIMutI CAGTG 2 cut(s) 246, 391
Cac8I GCNNGC 2 cut(s) 293, 792
CaiI CAGNNNCTG 1 cut(s) 713
ClaI ATCGAT 1 cut(s) 849
Csp6I GTAC 2 cut(s) 829, 924
CspCI CAANNNNNGTGG 2 cut(s) 367, 402
CviAII CATG 4 cut(s) 80, 167, 442, 806
CviJI RGCY 9 cut(s) 20, 68, 318, 395, 407, 457, 484, 737, 790
CviKI_1 RGCY 9 cut(s) 20, 68, 318, 395, 407, 457, 484, 737, 790
CviQI GTAC 2 cut(s) 829, 924
DdeI CTNAG 3 cut(s) 144, 462, 497
DpnI GATC 2 cut(s) 303, 921
DpnII GATC 2 cut(s) 301, 919
DraI TTTAAA 1 cut(s) 720
DrdI GACNNNNNNGTC 1 cut(s) 583
DriI GACNNNNNGTC 1 cut(s) 895
DseDI GACNNNNNNGTC 1 cut(s) 583
EaeI YGGCCR 1 cut(s) 482
Eam1105I GACNNNNNGTC 1 cut(s) 895
Eco130I CCWWGG 3 cut(s) 274, 479, 730
Eco32I GATATC 1 cut(s) 867
Eco88I CYCGRG 1 cut(s) 941
EcoRII CCWGG 3 cut(s) 190, 307, 660
EcoRV GATATC 1 cut(s) 867
EcoT14I CCWWGG 3 cut(s) 274, 479, 730
ErhI CCWWGG 3 cut(s) 274, 479, 730
FaeI CATG 4 cut(s) 83, 170, 445, 809
FalI AAGNNNNNCTT 2 cut(s) 267, 299
FaqI GGGAC 2 cut(s) 222, 486
FatI CATG 4 cut(s) 79, 166, 441, 805
FauNDI CATATG 2 cut(s) 34, 928
FbaI TGATCA 1 cut(s) 301
FblI GTMKAC 2 cut(s) 87, 555
Fnu4HI GCNGC 1 cut(s) 393
FokI GGATG 4 cut(s) 174, 559, 615, 698
Fsp4HI GCNGC 1 cut(s) 393
FspBI CTAG 1 cut(s) 257
GluI GCNGC 1 cut(s) 393
GsuI CTGGAG 2 cut(s) 285, 330
HaeIII GGCC 1 cut(s) 484
Hin1II CATG 4 cut(s) 83, 170, 445, 809
HincII GTYRAC 1 cut(s) 556
HindII GTYRAC 1 cut(s) 556
HinfI GANTC 7 cut(s) 43, 220, 270, 426, 499, 557, 896
HphI GGTGA 4 cut(s) 542, 586, 592, 634
Hpy166II GTNNAC 4 cut(s) 88, 512, 556, 596
Hpy188I TCNGA 5 cut(s) 145, 181, 431, 498, 763
Hpy188III TCNNGA 8 cut(s) 162, 264, 299, 503, 539, 632, 887, 941
Hpy8I GTNNAC 4 cut(s) 88, 512, 556, 596
HpyAV CCTTC 3 cut(s) 101, 565, 829
HpyCH4III ACNGT 1 cut(s) 580
HpyCH4V TGCA 5 cut(s) 239, 291, 392, 617, 805
HpyF10VI GCNNNNNNNGC 2 cut(s) 463, 791
HpyF3I CTNAG 3 cut(s) 144, 462, 497
Hsp92II CATG 4 cut(s) 83, 170, 445, 809
Ksp22I TGATCA 1 cut(s) 301
Kzo9I GATC 2 cut(s) 301, 919
LmnI GCTCC 2 cut(s) 734, 838
Lsp1109I GCAGC 1 cut(s) 404
LweI GCATC 4 cut(s) 149, 304, 626, 637
MaeI CTAG 1 cut(s) 257
MaeIII GTNAC 7 cut(s) 8, 53, 96, 169, 530, 574, 640
MalI GATC 2 cut(s) 303, 921
MboI GATC 2 cut(s) 301, 919
MboII GAAGA 3 cut(s) 114, 929, 963
MlsI TGGCCA 1 cut(s) 484
MluNI TGGCCA 1 cut(s) 484
MlyI GAGTC 5 cut(s) 214, 435, 508, 551, 905
MnlI CCTC 5 cut(s) 139, 199, 260, 321, 418
Mox20I TGGCCA 1 cut(s) 484
MscI TGGCCA 1 cut(s) 484
MseI TTAA 3 cut(s) 128, 719, 970
MslI CAYNNNNRTG 3 cut(s) 622, 633, 810
Msp20I TGGCCA 1 cut(s) 484
MspR9I CCNGG 3 cut(s) 192, 309, 662
MvaI CCWGG 3 cut(s) 192, 309, 662
MwoI GCNNNNNNNGC 2 cut(s) 463, 791
NdeI CATATG 2 cut(s) 34, 928
NdeII GATC 2 cut(s) 301, 919
NlaIII CATG 4 cut(s) 83, 170, 445, 809
NlaIV GGNNCC 1 cut(s) 659
NmuCI GTSAC 5 cut(s) 96, 169, 530, 574, 640
NspI RCATGY 2 cut(s) 170, 809
NspV TTCGAA 1 cut(s) 691
PaeR7I CTCGAG 1 cut(s) 941
PciI ACATGT 1 cut(s) 166
PcsI WCGNNNNNNNCGW 1 cut(s) 748
PfeI GAWTC 2 cut(s) 43, 270
PfoI TCCNGGA 1 cut(s) 190
PkrI GCNGC 1 cut(s) 394
PleI GAGTC 5 cut(s) 214, 434, 507, 551, 904
PpsI GAGTC 5 cut(s) 214, 434, 507, 551, 904
PscI ACATGT 1 cut(s) 166
Psp6I CCWGG 3 cut(s) 190, 307, 660
PspGI CCWGG 3 cut(s) 190, 307, 660
PspN4I GGNNCC 1 cut(s) 659
PstNI CAGNNNCTG 1 cut(s) 713
RsaI GTAC 2 cut(s) 830, 925
RsaNI GTAC 2 cut(s) 829, 924
RseI CAYNNNNRTG 3 cut(s) 622, 633, 810
SalI GTCGAC 1 cut(s) 554
SaqAI TTAA 3 cut(s) 128, 719, 970
SatI GCNGC 1 cut(s) 393
Sau3AI GATC 2 cut(s) 301, 919
SchI GAGTC 5 cut(s) 214, 435, 508, 551, 905
ScrFI CCNGG 3 cut(s) 192, 309, 662
SfaNI GCATC 4 cut(s) 149, 304, 626, 637
Sfr274I CTCGAG 1 cut(s) 941
SfuI TTCGAA 1 cut(s) 691
SlaI CTCGAG 1 cut(s) 941
SmiMI CAYNNNNRTG 3 cut(s) 622, 633, 810
SmlI CTYRAG 3 cut(s) 222, 409, 941
SmoI CTYRAG 3 cut(s) 222, 409, 941
SsiI CCGC 1 cut(s) 30
SspMI CTAG 1 cut(s) 257
StyD4I CCNGG 3 cut(s) 190, 307, 660
StyI CCWWGG 3 cut(s) 274, 479, 730
TaaI ACNGT 1 cut(s) 580
TaqI TCGA 5 cut(s) 326, 555, 691, 849, 942
TaqII GACCGA 1 cut(s) 732
TfiI GAWTC 2 cut(s) 43, 270
Tru1I TTAA 3 cut(s) 128, 719, 970
Tru9I TTAA 3 cut(s) 128, 719, 970
TscAI CASTG 2 cut(s) 246, 391
TseFI GTSAC 5 cut(s) 96, 169, 530, 574, 640
TseI GCWGC 1 cut(s) 392
Tsp45I GTSAC 5 cut(s) 96, 169, 530, 574, 640
TspDTI ATGAA 3 cut(s) 104, 114, 895
TspGWI ACGGA 2 cut(s) 461, 740
TspRI CASTG 2 cut(s) 246, 391
XceI RCATGY 2 cut(s) 170, 809
XhoI CTCGAG 1 cut(s) 941
XmiI GTMKAC 2 cut(s) 87, 555
XspI CTAG 1 cut(s) 257
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.