Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000909.1

Orthogroup ID

OG0001622

Physical Location & Seq

Genomic Coordinates Forward (+)

101613 .. 103773

Gene Structure 2161 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000909.1_g000027.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1119 bp

atggaagatgttcatgatgatgtgggtggcgaacttcgtggtagagaattggctagcttggagtactatgtgaatagtgaagtagatgataccactgatgttcaagcaagtagaggagaagacttccaaggtattccttgggatagacttagcattactagagagaaataccagcaaactaggttagaaagatacaagaattatgagaacattcctaattccagagaaggttgcgtaacttggtctgggctacatcaaagcatgatgtctaccttatgtcacatttttctgtcattcatgtcttcattaagttgcgaagcatctgaggttctaaatgtttcaggacatgtcacaccatcagagaaacatcctggaagtctcttggaaggatttacacagactcaagttagtagtcttgcagtgaaagataagttgctagttgccggaggattccaaggagaacttattttcaagcatcttgatcaacctggagttagcttttgttcgaggacaactgatgatgataatgccattacaaatgctattgagatttatgacaatcccagtggtgcagttcactttacatcctcaagtaatgattgtggagtcagagactttgacatggagacatttcagctttttaagcatttccgttttccttggccagcgaatcatacttctctgagtcccgatggtaaactttttgtgatagttggtgacaatccagatgggatgttggtcgactctcaaactggcaaggtggtatttactttacgcttttacggtgacgcctttgctactgggaagcaggacaaaacctgtcgggtttgggatgttcgaaacctatccaagtcagttgctgttttaaagggaaaccttggagctattcggtcaatccgttatacttctgatggtcagtatatgatgatggcagagccagcagactttgtgcatgtctatgatgtgaaaagtgggtacgagaaggagcaggaaatcgatttctttggagagatatctggcatatcattcagtccagacacagagtcgcttttcattggagtatgggatcgtacatacggtagtcttctcgagtatggaagacaaaagtgtgttgcttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF2415 WD40

Protein Analysis

372

Amino Acids

41.66

Weight (kDa)

4.86

Isoelectric Point (pI)

29.1

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001622)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G55680 AT3G13340 AT3G13340 AT3G13340
fragaria_vesca	FvH4_3g41630 FvH4_3g41640 FvH4_3g41650
malus_domestica	MD03G1042700.v1.1 MD03G1216600.v1.1 MD05G1255200.v1.1 MD11G1044000.v1.1 MD11G1045800.v1.1
prunus_persica	Prupe.6G035100_v2.0.a1 Prupe.6G035100_v2.0.a1 Prupe.6G035100_v2.0.a1
pyrus_communis	pycom03g03290 pycom11g03710
rosa_chinensis	RchiOBHm_Chr5g0074671 RchiOBHm_Chr5g0074681 RchiOBHm_Chr5g0074701 RchiOBHm_Chr5g0074741
rosa_laevigata	RLG00000036497
rosa_multiflora	Rmu_sc0000909.1_g000023 Rmu_sc0000909.1_g000027 Rmu_sc0008028.1_g000001 Rmu_sc0019386.1_g000002 Rmu_sc0019386.1_g000003
rosa_roxburghii	Rroxscaffold_1G00006840 Rroxscaffold_1G00006860 Rroxscaffold_1G00006870
rosa_rugosa	Rorug05G0433500 Rorug05G0433600
rosa_samantha	Rh5AG490700 Rh5AG490800 Rh5AG491100 Rh5BG511800 Rh5BG512000 Rh5BG512300 Rh5BG512400 Rh5BG512500 Rh5CG535600 Rh5CG535700 Rh5CG536000 Rh5CG536100 Rh5DG524200 Rh5DG524500
rosa_wichuraiana	Rw5G045450 Rw5G045460 Rw5G045490

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	2 cut(s)	269, 741
AclWI	GGATC	1 cut(s)	1074
AcoI	YGGCCR	1 cut(s)	662
AcyI	GRCGYC	1 cut(s)	789
AfaI	GTAC	3 cut(s)	65, 977, 1072
AflIII	ACRYGT	1 cut(s)	346
AgsI	TTSAA	2 cut(s)	104, 472
AhdI	GACNNNNNGTC	1 cut(s)	1042
AjnI	CCWGG	2 cut(s)	370, 487
AluBI	AGCT	4 cut(s)	57, 498, 637, 884
AluI	AGCT	4 cut(s)	57, 498, 637, 884
Alw26I	GTCTC	3 cut(s)	383, 606, 620
AlwI	GGATC	1 cut(s)	1074
AlwNI	CAGNNNCTG	1 cut(s)	860
Ama87I	CYCGRG	1 cut(s)	1088
AoxI	GGCC	1 cut(s)	662
Asp700I	GAANNNNTTC	1 cut(s)	9
AsuHPI	GGTGA	2 cut(s)	728, 797
AsuII	TTCGAA	1 cut(s)	838
AsuNHI	GCTAGC	1 cut(s)	53
AvaI	CYCGRG	1 cut(s)	1088
BalI	TGGCCA	1 cut(s)	664
BbsI	GAAGAC	4 cut(s)	126, 294, 1076, 1105
BccI	CCATC	5 cut(s)	364, 686, 722, 905, 922
BciT130I	CCWGG	2 cut(s)	372, 489
BclI	TGATCA	1 cut(s)	481
BcoDI	GTCTC	3 cut(s)	383, 606, 620
BfaI	CTAG	4 cut(s)	54, 159, 180, 437
BmcAI	AGTACT	1 cut(s)	65
Bme1390I	CCNGG	2 cut(s)	372, 489
BmeRI	GACNNNNNGTC	1 cut(s)	1042
BmeT110I	CYCGRG	1 cut(s)	1088
BmrFI	CCNGG	2 cut(s)	372, 489
BmrI	ACTGGG	2 cut(s)	558, 810
BmsI	GCATC	2 cut(s)	329, 484
BmtI	GCTAGC	1 cut(s)	57
BmuI	ACTGGG	2 cut(s)	558, 810
BpiI	GAAGAC	4 cut(s)	126, 294, 1076, 1105
BpmI	CTGGAG	1 cut(s)	510
Bpu14I	TTCGAA	1 cut(s)	838
BpuEI	CTTGAG	2 cut(s)	387, 574
Bsa29I	ATCGAT	1 cut(s)	996
BsaHI	GRCGYC	1 cut(s)	789
BsaJI	CCNNGG	5 cut(s)	127, 137, 454, 659, 877
Bse1I	ACTGG	3 cut(s)	564, 757, 805
BseBI	CCWGG	2 cut(s)	372, 489
BseCI	ATCGAT	1 cut(s)	996
BseDI	CCNNGG	5 cut(s)	127, 137, 454, 659, 877
BseGI	GGATG	4 cut(s)	367, 584, 738, 838
BseMII	CTCAG	2 cut(s)	315, 674
BseNI	ACTGG	3 cut(s)	564, 757, 805
BseRI	GAGGAG	1 cut(s)	129
BsgI	GTGCAG	1 cut(s)	591
BshFI	GGCC	1 cut(s)	664
BshVI	ATCGAT	1 cut(s)	996
BsiHKCI	CYCGRG	1 cut(s)	1088
BsiSI	CCGG	1 cut(s)	444
BslFI	GGGAC	1 cut(s)	672
BsmAI	GTCTC	3 cut(s)	383, 606, 620
BsmFI	GGGAC	1 cut(s)	672
BsnI	GGCC	1 cut(s)	664
BsoBI	CYCGRG	1 cut(s)	1088
Bsp119I	TTCGAA	1 cut(s)	838
Bsp143I	GATC	2 cut(s)	481, 1066
BspANI	GGCC	1 cut(s)	664
BspCNI	CTCAG	2 cut(s)	316, 675
BspDI	ATCGAT	1 cut(s)	996
BspHI	TCATGA	1 cut(s)	13
BspOI	GCTAGC	1 cut(s)	57
BspPI	GGATC	1 cut(s)	1074
BspT104I	TTCGAA	1 cut(s)	838
BsrI	ACTGG	3 cut(s)	564, 757, 805
BssECI	CCNNGG	5 cut(s)	127, 137, 454, 659, 877
BssMI	GATC	2 cut(s)	481, 1066
BssNI	GRCGYC	1 cut(s)	789
BssT1I	CCWWGG	5 cut(s)	127, 137, 454, 659, 877
Bst2UI	CCWGG	2 cut(s)	372, 489
Bst4CI	ACNGT	2 cut(s)	785, 1079
BstACI	GRCGYC	1 cut(s)	789
BstBI	TTCGAA	1 cut(s)	838
BstC8I	GCNNGC	3 cut(s)	55, 666, 939
BstDEI	CTNAG	3 cut(s)	149, 324, 683
BstF5I	GGATG	4 cut(s)	367, 584, 738, 838
BstKTI	GATC	2 cut(s)	484, 1069
BstMAI	GTCTC	3 cut(s)	383, 606, 620
BstMBI	GATC	2 cut(s)	481, 1066
BstMWI	GCNNNNNNNGC	2 cut(s)	643, 938
BstNI	CCWGG	2 cut(s)	372, 489
BstNSI	RCATGY	2 cut(s)	350, 956
BstSCI	CCNGG	2 cut(s)	370, 487
BstV2I	GAAGAC	4 cut(s)	126, 294, 1076, 1105
Bsu15I	ATCGAT	1 cut(s)	996
BsuRI	GGCC	1 cut(s)	664
BsuTUI	ATCGAT	1 cut(s)	996
BtsCI	GGATG	4 cut(s)	367, 584, 738, 838
BtsI	GCAGTG	1 cut(s)	426
BtsIMutI	CAGTG	3 cut(s)	93, 426, 571
Cac8I	GCNNGC	3 cut(s)	55, 666, 939
CaiI	CAGNNNCTG	1 cut(s)	860
CciI	TCATGA	1 cut(s)	13
ClaI	ATCGAT	1 cut(s)	996
CseI	GACGC	1 cut(s)	797
Csp6I	GTAC	3 cut(s)	64, 976, 1071
CspCI	CAANNNNNGTGG	2 cut(s)	547, 582
CviAII	CATG	6 cut(s)	14, 262, 298, 347, 622, 953
CviJI	RGCY	8 cut(s)	53, 57, 250, 498, 637, 664, 884, 937
CviKI_1	RGCY	8 cut(s)	53, 57, 250, 498, 637, 664, 884, 937
CviQI	GTAC	3 cut(s)	64, 976, 1071
DdeI	CTNAG	3 cut(s)	149, 324, 683
DpnI	GATC	2 cut(s)	483, 1068
DpnII	GATC	2 cut(s)	481, 1066
DraI	TTTAAA	1 cut(s)	867
DriI	GACNNNNNGTC	1 cut(s)	1042
EaeI	YGGCCR	1 cut(s)	662
Eam1105I	GACNNNNNGTC	1 cut(s)	1042
Eco130I	CCWWGG	5 cut(s)	127, 137, 454, 659, 877
Eco32I	GATATC	1 cut(s)	1014
Eco88I	CYCGRG	1 cut(s)	1088
EcoRII	CCWGG	2 cut(s)	370, 487
EcoRV	GATATC	1 cut(s)	1014
EcoT14I	CCWWGG	5 cut(s)	127, 137, 454, 659, 877
ErhI	CCWWGG	5 cut(s)	127, 137, 454, 659, 877
FaeI	CATG	6 cut(s)	17, 265, 301, 350, 625, 956
FalI	AAGNNNNNCTT	2 cut(s)	447, 479
FaqI	GGGAC	1 cut(s)	672
FatI	CATG	6 cut(s)	13, 261, 297, 346, 621, 952
FbaI	TGATCA	1 cut(s)	481
FblI	GTMKAC	2 cut(s)	269, 741
FokI	GGATG	4 cut(s)	354, 571, 745, 845
FspBI	CTAG	4 cut(s)	54, 159, 180, 437
GsuI	CTGGAG	1 cut(s)	510
HaeIII	GGCC	1 cut(s)	664
HapII	CCGG	1 cut(s)	444
HgaI	GACGC	1 cut(s)	797
Hin1I	GRCGYC	1 cut(s)	789
Hin1II	CATG	6 cut(s)	17, 265, 301, 350, 625, 956
HincII	GTYRAC	1 cut(s)	742
HindII	GTYRAC	1 cut(s)	742
HinfI	GANTC	7 cut(s)	400, 450, 606, 670, 685, 743, 1043
HpaII	CCGG	1 cut(s)	444
HphI	GGTGA	2 cut(s)	728, 797
Hpy166II	GTNNAC	4 cut(s)	270, 577, 698, 742
Hpy188I	TCNGA	5 cut(s)	325, 361, 611, 684, 910
Hpy188III	TCNNGA	8 cut(s)	14, 222, 342, 479, 689, 725, 1034, 1088
Hpy8I	GTNNAC	4 cut(s)	270, 577, 698, 742
HpyAV	CCTTC	3 cut(s)	221, 380, 976
HpyCH4III	ACNGT	2 cut(s)	785, 1079
HpyCH4V	TGCA	3 cut(s)	419, 572, 952
HpyF10VI	GCNNNNNNNGC	2 cut(s)	643, 938
HpyF3I	CTNAG	3 cut(s)	149, 324, 683
Hsp92I	GRCGYC	1 cut(s)	789
Hsp92II	CATG	6 cut(s)	17, 265, 301, 350, 625, 956
Ksp22I	TGATCA	1 cut(s)	481
Kzo9I	GATC	2 cut(s)	481, 1066
LmnI	GCTCC	2 cut(s)	881, 985
LweI	GCATC	2 cut(s)	329, 484
MaeI	CTAG	4 cut(s)	54, 159, 180, 437
MaeIII	GTNAC	5 cut(s)	235, 278, 349, 716, 785
MalI	GATC	2 cut(s)	483, 1068
MboI	GATC	2 cut(s)	481, 1066
MboII	GAAGA	5 cut(s)	17, 131, 294, 1076, 1110
MlsI	TGGCCA	1 cut(s)	664
MluCI	AATT	3 cut(s)	47, 199, 217
MluNI	TGGCCA	1 cut(s)	664
MlyI	GAGTC	5 cut(s)	394, 615, 694, 737, 1052
MnlI	CCTC	5 cut(s)	107, 319, 440, 501, 598
Mox20I	TGGCCA	1 cut(s)	664
MroXI	GAANNNNTTC	1 cut(s)	9
MscI	TGGCCA	1 cut(s)	664
MseI	TTAA	4 cut(s)	308, 642, 866, 1117
MslI	CAYNNNNRTG	2 cut(s)	18, 957
Msp20I	TGGCCA	1 cut(s)	664
MspI	CCGG	1 cut(s)	444
MspR9I	CCNGG	2 cut(s)	372, 489
MvaI	CCWGG	2 cut(s)	372, 489
MwoI	GCNNNNNNNGC	2 cut(s)	643, 938
NdeII	GATC	2 cut(s)	481, 1066
NheI	GCTAGC	1 cut(s)	53
NlaIII	CATG	6 cut(s)	17, 265, 301, 350, 625, 956
NmuCI	GTSAC	4 cut(s)	278, 349, 716, 785
NspI	RCATGY	2 cut(s)	350, 956
NspV	TTCGAA	1 cut(s)	838
PaeR7I	CTCGAG	1 cut(s)	1088
PagI	TCATGA	1 cut(s)	13
PciI	ACATGT	1 cut(s)	346
PcsI	WCGNNNNNNNCGW	1 cut(s)	895
PdmI	GAANNNNTTC	1 cut(s)	9
PfeI	GAWTC	2 cut(s)	450, 670
PfoI	TCCNGGA	1 cut(s)	370
PleI	GAGTC	5 cut(s)	394, 614, 693, 737, 1051
PpsI	GAGTC	5 cut(s)	394, 614, 693, 737, 1051
PscI	ACATGT	1 cut(s)	346
Psp6I	CCWGG	2 cut(s)	370, 487
PspGI	CCWGG	2 cut(s)	370, 487
PstNI	CAGNNNCTG	1 cut(s)	860
RsaI	GTAC	3 cut(s)	65, 977, 1072
RsaNI	GTAC	3 cut(s)	64, 976, 1071
RseI	CAYNNNNRTG	2 cut(s)	18, 957
SalI	GTCGAC	1 cut(s)	740
SaqAI	TTAA	4 cut(s)	308, 642, 866, 1117
Sau3AI	GATC	2 cut(s)	481, 1066
ScaI	AGTACT	1 cut(s)	65
SchI	GAGTC	5 cut(s)	394, 615, 694, 737, 1052
ScrFI	CCNGG	2 cut(s)	372, 489
SfaNI	GCATC	2 cut(s)	329, 484
Sfr274I	CTCGAG	1 cut(s)	1088
SfuI	TTCGAA	1 cut(s)	838
SlaI	CTCGAG	1 cut(s)	1088
SmiMI	CAYNNNNRTG	2 cut(s)	18, 957
SmlI	CTYRAG	3 cut(s)	402, 589, 1088
SmoI	CTYRAG	3 cut(s)	402, 589, 1088
Sse9I	AATT	3 cut(s)	47, 199, 217
SspMI	CTAG	4 cut(s)	54, 159, 180, 437
StyD4I	CCNGG	2 cut(s)	370, 487
StyI	CCWWGG	5 cut(s)	127, 137, 454, 659, 877
TaaI	ACNGT	2 cut(s)	785, 1079
TaqI	TCGA	5 cut(s)	506, 741, 838, 996, 1089
TaqII	GACCGA	1 cut(s)	879
TasI	AATT	3 cut(s)	47, 199, 217
TatI	WGTACW	1 cut(s)	63
TfiI	GAWTC	2 cut(s)	450, 670
Tru1I	TTAA	4 cut(s)	308, 642, 866, 1117
Tru9I	TTAA	4 cut(s)	308, 642, 866, 1117
TscAI	CASTG	3 cut(s)	100, 426, 571
TseFI	GTSAC	4 cut(s)	278, 349, 716, 785
Tsp45I	GTSAC	4 cut(s)	278, 349, 716, 785
TspDTI	ATGAA	3 cut(s)	286, 294, 1042
TspGWI	ACGGA	2 cut(s)	641, 887
TspRI	CASTG	3 cut(s)	100, 426, 571
XceI	RCATGY	2 cut(s)	350, 956
XhoI	CTCGAG	1 cut(s)	1088
XmiI	GTMKAC	2 cut(s)	269, 741
XmnI	GAANNNNTTC	1 cut(s)	9
XspI	CTAG	4 cut(s)	54, 159, 180, 437
ZrmI	AGTACT	1 cut(s)	65

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.