Rmu_sc0001227.1_g000040

40S ribosomal protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001227.1
Physical Location & Seq
Reverse (-)
187894 .. 188363
470 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001227.1_g000040.1.cds

Sequence Viewer

Length: 273 bp
atggaatcctcagtgaagcatgctgttgtcgtgaaagttatgggtcggactggatcccgaggacaggtgactcaggttaaagtcaagtttctggacgatcaaaaccggcatatcatgaggaatgtcaaaggaccagtgagggagggagatattcttaccttgctcgagtctgaaagggaagcgaggaggttgcggaatgtcaaaggaccagtgagggagggagatattcttaccttgctcgagtctgaaagggaagcgaggaggttgcggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

90

Amino Acids

10.33

Weight (kDa)

10.8

Isoelectric Point (pI)

48.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 193, 268
AclWI GGATC 2 cut(s) 48, 61
AfiI CCNNNNNNNGG 1 cut(s) 64
AlwI GGATC 2 cut(s) 48, 61
Ama87I CYCGRG 3 cut(s) 57, 164, 239
AspS9I GGNCC 2 cut(s) 131, 206
AsuHPI GGTGA 1 cut(s) 79
AvaI CYCGRG 3 cut(s) 57, 164, 239
AvaII GGWCC 2 cut(s) 131, 206
BamHI GGATCC 1 cut(s) 53
BcgI CGANNNNNNTGC 3 cut(s) 172, 206, 247
Bme18I GGWCC 2 cut(s) 131, 206
BmeT110I CYCGRG 3 cut(s) 57, 164, 239
BmgT120I GGNCC 2 cut(s) 131, 206
BmiI GGNNCC 1 cut(s) 55
BsaJI CCNNGG 1 cut(s) 58
Bsc4I CCNNNNNNNGG 1 cut(s) 64
Bse118I RCCGGY 1 cut(s) 105
Bse1I ACTGG 3 cut(s) 55, 134, 209
BseDI CCNNGG 1 cut(s) 58
BseLI CCNNNNNNNGG 1 cut(s) 64
BseMII CTCAG 2 cut(s) 24, 86
BseNI ACTGG 3 cut(s) 55, 134, 209
BseRI GAGGAG 1 cut(s) 199
BsiHKCI CYCGRG 3 cut(s) 57, 164, 239
BsiSI CCGG 1 cut(s) 106
BslI CCNNNNNNNGG 1 cut(s) 64
BsoBI CYCGRG 3 cut(s) 57, 164, 239
Bsp143I GATC 2 cut(s) 53, 97
BspACI CCGC 2 cut(s) 193, 268
BspCNI CTCAG 2 cut(s) 23, 85
BspHI TCATGA 1 cut(s) 114
BspLI GGNNCC 1 cut(s) 55
BspPI GGATC 2 cut(s) 48, 61
BsrFI RCCGGY 1 cut(s) 105
BsrI ACTGG 3 cut(s) 55, 134, 209
BssAI RCCGGY 1 cut(s) 105
BssECI CCNNGG 1 cut(s) 58
BssMI GATC 2 cut(s) 53, 97
BstC8I GCNNGC 1 cut(s) 21
BstDEI CTNAG 2 cut(s) 10, 72
BstKTI GATC 2 cut(s) 56, 100
BstMBI GATC 2 cut(s) 53, 97
BstNSI RCATGY 1 cut(s) 23
BstX2I RGATCY 1 cut(s) 53
BstYI RGATCY 1 cut(s) 53
BtsIMutI CAGTG 3 cut(s) 18, 141, 216
Cac8I GCNNGC 1 cut(s) 21
CciI TCATGA 1 cut(s) 114
Cfr10I RCCGGY 1 cut(s) 105
Cfr13I GGNCC 2 cut(s) 131, 206
CviAII CATG 2 cut(s) 20, 115
DdeI CTNAG 2 cut(s) 10, 72
DpnI GATC 2 cut(s) 55, 99
DpnII GATC 2 cut(s) 53, 97
Eco47I GGWCC 2 cut(s) 131, 206
Eco88I CYCGRG 3 cut(s) 57, 164, 239
FaeI CATG 2 cut(s) 23, 118
FaiI YATR 4 cut(s) 21, 41, 111, 116
FatI CATG 2 cut(s) 19, 114
HapII CCGG 1 cut(s) 106
Hin1II CATG 2 cut(s) 23, 118
HinfI GANTC 4 cut(s) 5, 70, 167, 242
HpaII CCGG 1 cut(s) 106
HphI GGTGA 1 cut(s) 79
Hpy188I TCNGA 3 cut(s) 48, 172, 247
Hpy188III TCNNGA 4 cut(s) 31, 57, 92, 115
HpyF3I CTNAG 2 cut(s) 10, 72
Hsp92II CATG 2 cut(s) 23, 118
Kzo9I GATC 2 cut(s) 53, 97
LpnPI CCDG 7 cut(s) 36, 50, 59, 77, 119, 147, 222
MaeIII GTNAC 1 cut(s) 67
MalI GATC 2 cut(s) 55, 99
MboI GATC 2 cut(s) 53, 97
MflI RGATCY 1 cut(s) 53
MlyI GAGTC 3 cut(s) 64, 176, 251
MmeI TCCRAC 1 cut(s) 26
MseI TTAA 1 cut(s) 78
MspI CCGG 1 cut(s) 106
NdeII GATC 2 cut(s) 53, 97
NlaIII CATG 2 cut(s) 23, 118
NlaIV GGNNCC 1 cut(s) 55
NmuCI GTSAC 1 cut(s) 67
NspI RCATGY 1 cut(s) 23
PaeI GCATGC 1 cut(s) 23
PaeR7I CTCGAG 2 cut(s) 164, 239
PagI TCATGA 1 cut(s) 114
PfeI GAWTC 1 cut(s) 5
PleI GAGTC 3 cut(s) 64, 175, 250
PpsI GAGTC 3 cut(s) 64, 175, 250
PspN4I GGNNCC 1 cut(s) 55
PspPI GGNCC 2 cut(s) 131, 206
PspXI VCTCGAGB 2 cut(s) 164, 239
PsuI RGATCY 1 cut(s) 53
SaqAI TTAA 1 cut(s) 78
Sau3AI GATC 2 cut(s) 53, 97
Sau96I GGNCC 2 cut(s) 131, 206
SchI GAGTC 3 cut(s) 64, 176, 251
SetI ASST 6 cut(s) 69, 78, 161, 191, 236, 266
Sfr274I CTCGAG 2 cut(s) 164, 239
SinI GGWCC 2 cut(s) 131, 206
SlaI CTCGAG 2 cut(s) 164, 239
SmlI CTYRAG 2 cut(s) 164, 239
SmoI CTYRAG 2 cut(s) 164, 239
SphI GCATGC 1 cut(s) 23
SsiI CCGC 2 cut(s) 193, 268
TaqI TCGA 2 cut(s) 165, 240
TfiI GAWTC 1 cut(s) 5
Tru1I TTAA 1 cut(s) 78
Tru9I TTAA 1 cut(s) 78
TscAI CASTG 3 cut(s) 18, 141, 216
TseFI GTSAC 1 cut(s) 67
Tsp45I GTSAC 1 cut(s) 67
TspRI CASTG 3 cut(s) 18, 141, 216
VpaK11BI GGWCC 2 cut(s) 131, 206
XceI RCATGY 1 cut(s) 23
XhoI CTCGAG 2 cut(s) 164, 239
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.