Rw6G030820

40S ribosomal protein

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr6
Physical Location & Seq
Forward (+)
54895770 .. 54896235
466 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw6G030820.1

Sequence Viewer

Length: 198 bp
ATGGAATCCTCAGTGAAGCATGCTTTTGTTGTGAAAGTTATGGGTCGGACTGGATCTCGAGGACAGGTGACTCAGGTTAAAGTCAAGTTTATGGACGATCCCAATCGGCACATCATGAGGAATGTCAAAGGACCAGTGAGGGAGGGGGATATCCTTACCTTGCTTGAGTCTGAAAGGGAAGCAAGGAGGTTGCGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

65

Amino Acids

7.48

Weight (kDa)

10.86

Isoelectric Point (pI)

39.29

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S28e PF01200 4 - 64 1e-31 Ribosomal protein S28e
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 61, 92
AlwI GGATC 2 cut(s) 61, 92
Ama87I CYCGRG 1 cut(s) 57
AspS9I GGNCC 1 cut(s) 131
AsuHPI GGTGA 1 cut(s) 79
AvaI CYCGRG 1 cut(s) 57
AvaII GGWCC 1 cut(s) 131
Bme18I GGWCC 1 cut(s) 131
BmeT110I CYCGRG 1 cut(s) 57
BmgT120I GGNCC 1 cut(s) 131
BpuEI CTTGAG 1 cut(s) 185
BsaBI GATNNNNATC 1 cut(s) 102
BsaXI ACNNNNNCTCC 1 cut(s) 178
Bse1I ACTGG 2 cut(s) 55, 134
Bse8I GATNNNNATC 1 cut(s) 102
BseJI GATNNNNATC 1 cut(s) 102
BseMII CTCAG 2 cut(s) 24, 86
BseNI ACTGG 2 cut(s) 55, 134
BsiHKCI CYCGRG 1 cut(s) 57
BsoBI CYCGRG 1 cut(s) 57
Bsp143I GATC 2 cut(s) 53, 97
BspCNI CTCAG 2 cut(s) 23, 85
BspHI TCATGA 1 cut(s) 114
BspPI GGATC 2 cut(s) 61, 92
BsrI ACTGG 2 cut(s) 55, 134
BssMI GATC 2 cut(s) 53, 97
BstC8I GCNNGC 1 cut(s) 21
BstDEI CTNAG 2 cut(s) 10, 72
BstKTI GATC 2 cut(s) 56, 100
BstMBI GATC 2 cut(s) 53, 97
BstNSI RCATGY 1 cut(s) 23
BstX2I RGATCY 1 cut(s) 53
BstYI RGATCY 1 cut(s) 53
BtsIMutI CAGTG 2 cut(s) 18, 141
Cac8I GCNNGC 1 cut(s) 21
CciI TCATGA 1 cut(s) 114
Cfr13I GGNCC 1 cut(s) 131
CviAII CATG 2 cut(s) 20, 115
DdeI CTNAG 2 cut(s) 10, 72
DpnI GATC 2 cut(s) 55, 99
DpnII GATC 2 cut(s) 53, 97
Eco32I GATATC 1 cut(s) 151
Eco47I GGWCC 1 cut(s) 131
Eco88I CYCGRG 1 cut(s) 57
EcoRV GATATC 1 cut(s) 151
FaeI CATG 2 cut(s) 23, 118
FaiI YATR 4 cut(s) 21, 41, 92, 116
FatI CATG 2 cut(s) 19, 114
Hin1II CATG 2 cut(s) 23, 118
HinfI GANTC 3 cut(s) 5, 70, 167
HphI GGTGA 1 cut(s) 79
Hpy188I TCNGA 2 cut(s) 48, 172
Hpy188III TCNNGA 2 cut(s) 57, 115
HpyF3I CTNAG 2 cut(s) 10, 72
Hsp92II CATG 2 cut(s) 23, 118
Kzo9I GATC 2 cut(s) 53, 97
LpnPI CCDG 4 cut(s) 36, 50, 59, 147
MaeIII GTNAC 1 cut(s) 67
MalI GATC 2 cut(s) 55, 99
MboI GATC 2 cut(s) 53, 97
MflI RGATCY 1 cut(s) 53
MlyI GAGTC 2 cut(s) 64, 176
MmeI TCCRAC 1 cut(s) 26
MnlI CCTC 6 cut(s) 19, 53, 111, 132, 136, 180
MseI TTAA 1 cut(s) 78
NdeII GATC 2 cut(s) 53, 97
NlaIII CATG 2 cut(s) 23, 118
NmuCI GTSAC 1 cut(s) 67
NspI RCATGY 1 cut(s) 23
PaeI GCATGC 1 cut(s) 23
PaeR7I CTCGAG 1 cut(s) 57
PagI TCATGA 1 cut(s) 114
PfeI GAWTC 1 cut(s) 5
PleI GAGTC 2 cut(s) 64, 175
PpsI GAGTC 2 cut(s) 64, 175
PspPI GGNCC 1 cut(s) 131
PsuI RGATCY 1 cut(s) 53
SaqAI TTAA 1 cut(s) 78
Sau3AI GATC 2 cut(s) 53, 97
Sau96I GGNCC 1 cut(s) 131
SchI GAGTC 2 cut(s) 64, 176
SetI ASST 4 cut(s) 69, 78, 161, 191
Sfr274I CTCGAG 1 cut(s) 57
SinI GGWCC 1 cut(s) 131
SlaI CTCGAG 1 cut(s) 57
SmlI CTYRAG 2 cut(s) 57, 164
SmoI CTYRAG 2 cut(s) 57, 164
SphI GCATGC 1 cut(s) 23
TaqI TCGA 1 cut(s) 58
TfiI GAWTC 1 cut(s) 5
Tru1I TTAA 1 cut(s) 78
Tru9I TTAA 1 cut(s) 78
TscAI CASTG 2 cut(s) 18, 141
TseFI GTSAC 1 cut(s) 67
Tsp45I GTSAC 1 cut(s) 67
TspRI CASTG 2 cut(s) 18, 141
VpaK11BI GGWCC 1 cut(s) 131
XceI RCATGY 1 cut(s) 23
XhoI CTCGAG 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.