Rh7DG044700

40S ribosomal protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Forward (+)
3404506 .. 3405895
1390 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG044700.1

Sequence Viewer

Length: 198 bp
ATGGAATCGACTGTGAAGCACGCCCTGGTGGTGAAGGTGATGGGCCGGACCGGATCTAGAGGTCAGGTGACCCAAGTCCGAGTCAAGTTTCTCGACGACCAGAACCGGTTCATCATGAGGAACGTCAAGGGACCGGTCCGGGAGGGCGACATCCTCACCCTGCTCGAGTCCGAGAGAGAAGCAAGAAGGTTGCGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

65

Amino Acids

7.51

Weight (kDa)

11.16

Isoelectric Point (pI)

28.36

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S28e PF01200 4 - 64 5e-32 Ribosomal protein S28e
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 61
AgeI ACCGGT 2 cut(s) 105, 133
AjnI CCWGG 1 cut(s) 24
AlwI GGATC 1 cut(s) 61
Ama87I CYCGRG 1 cut(s) 164
AoxI GGCC 1 cut(s) 43
AsiGI ACCGGT 2 cut(s) 105, 133
Asp700I GAANNNNTTC 1 cut(s) 107
AspS9I GGNCC 4 cut(s) 43, 48, 131, 136
AsuC2I CCSGG 1 cut(s) 140
AsuHPI GGTGA 4 cut(s) 43, 49, 79, 148
AvaI CYCGRG 1 cut(s) 164
AvaII GGWCC 3 cut(s) 48, 131, 136
BccI CCATC 1 cut(s) 34
BciT130I CCWGG 1 cut(s) 26
BcnI CCSGG 1 cut(s) 140
BfaI CTAG 1 cut(s) 57
Bme1390I CCNGG 2 cut(s) 26, 140
Bme18I GGWCC 3 cut(s) 48, 131, 136
BmeT110I CYCGRG 1 cut(s) 164
BmgT120I GGNCC 4 cut(s) 43, 48, 131, 136
BmiI GGNNCC 1 cut(s) 132
BmrFI CCNGG 2 cut(s) 26, 140
BoxI GACNNNNGTC 1 cut(s) 74
BpuMI CCSGG 1 cut(s) 140
BsaJI CCNNGG 1 cut(s) 24
BsaWI WCCGGW 3 cut(s) 50, 105, 133
Bse118I RCCGGY 2 cut(s) 105, 133
BseBI CCWGG 1 cut(s) 26
BseDI CCNNGG 1 cut(s) 24
BseGI GGATG 1 cut(s) 150
BshFI GGCC 1 cut(s) 45
BshTI ACCGGT 2 cut(s) 105, 133
BsiHKCI CYCGRG 1 cut(s) 164
BsiSI CCGG 5 cut(s) 46, 51, 106, 134, 139
BslFI GGGAC 1 cut(s) 144
BsmFI GGGAC 1 cut(s) 144
BsnI GGCC 1 cut(s) 45
BsoBI CYCGRG 1 cut(s) 164
Bsp143I GATC 1 cut(s) 53
BspANI GGCC 1 cut(s) 45
BspHI TCATGA 1 cut(s) 114
BspLI GGNNCC 1 cut(s) 132
BspPI GGATC 1 cut(s) 61
BsrFI RCCGGY 2 cut(s) 105, 133
BssAI RCCGGY 2 cut(s) 105, 133
BssECI CCNNGG 1 cut(s) 24
BssMI GATC 1 cut(s) 53
Bst2UI CCWGG 1 cut(s) 26
Bst4CI ACNGT 1 cut(s) 13
BstC8I GCNNGC 1 cut(s) 21
BstEII GGTNACC 1 cut(s) 67
BstF5I GGATG 1 cut(s) 150
BstKTI GATC 1 cut(s) 56
BstMBI GATC 1 cut(s) 53
BstNI CCWGG 1 cut(s) 26
BstPAI GACNNNNGTC 1 cut(s) 74
BstPI GGTNACC 1 cut(s) 67
BstSCI CCNGG 2 cut(s) 24, 138
BstX2I RGATCY 1 cut(s) 53
BstYI RGATCY 1 cut(s) 53
BsuRI GGCC 1 cut(s) 45
BtsCI GGATG 1 cut(s) 150
Cac8I GCNNGC 1 cut(s) 21
CciI TCATGA 1 cut(s) 114
Cfr10I RCCGGY 2 cut(s) 105, 133
Cfr13I GGNCC 4 cut(s) 43, 48, 131, 136
CpoI CGGWCCG 2 cut(s) 48, 136
CspAI ACCGGT 2 cut(s) 105, 133
CspI CGGWCCG 2 cut(s) 48, 136
CviAII CATG 1 cut(s) 115
CviJI RGCY 1 cut(s) 45
CviKI_1 RGCY 1 cut(s) 45
DpnI GATC 1 cut(s) 55
DpnII GATC 1 cut(s) 53
Eco47I GGWCC 3 cut(s) 48, 131, 136
Eco88I CYCGRG 1 cut(s) 164
Eco91I GGTNACC 1 cut(s) 67
EcoO65I GGTNACC 1 cut(s) 67
EcoRII CCWGG 1 cut(s) 24
FaeI CATG 1 cut(s) 118
FaiI YATR 1 cut(s) 116
FaqI GGGAC 1 cut(s) 144
FatI CATG 1 cut(s) 114
FokI GGATG 1 cut(s) 137
FspBI CTAG 1 cut(s) 57
HaeIII GGCC 1 cut(s) 45
HapII CCGG 5 cut(s) 46, 51, 106, 134, 139
Hin1II CATG 1 cut(s) 118
HinfI GANTC 3 cut(s) 5, 81, 167
HpaII CCGG 5 cut(s) 46, 51, 106, 134, 139
HphI GGTGA 4 cut(s) 43, 49, 79, 148
Hpy188I TCNGA 2 cut(s) 80, 172
Hpy188III TCNNGA 3 cut(s) 57, 92, 115
Hpy99I CGWCG 1 cut(s) 98
HpyAV CCTTC 2 cut(s) 28, 180
HpyCH4III ACNGT 1 cut(s) 13
HpyCH4IV ACGT 1 cut(s) 123
HpySE526I ACGT 1 cut(s) 123
Hsp92II CATG 1 cut(s) 118
Kzo9I GATC 1 cut(s) 53
MaeI CTAG 1 cut(s) 57
MaeII ACGT 1 cut(s) 123
MaeIII GTNAC 1 cut(s) 67
MalI GATC 1 cut(s) 55
MboI GATC 1 cut(s) 53
MflI RGATCY 1 cut(s) 53
MlyI GAGTC 2 cut(s) 90, 176
MnlI CCTC 4 cut(s) 53, 111, 136, 164
MroXI GAANNNNTTC 1 cut(s) 107
MspI CCGG 5 cut(s) 46, 51, 106, 134, 139
MspR9I CCNGG 2 cut(s) 26, 140
MvaI CCWGG 1 cut(s) 26
NciI CCSGG 1 cut(s) 140
NdeII GATC 1 cut(s) 53
NlaIII CATG 1 cut(s) 118
NlaIV GGNNCC 1 cut(s) 132
NmuCI GTSAC 1 cut(s) 67
PaeR7I CTCGAG 1 cut(s) 164
PagI TCATGA 1 cut(s) 114
PdmI GAANNNNTTC 1 cut(s) 107
PfeI GAWTC 1 cut(s) 5
PfoI TCCNGGA 1 cut(s) 138
PinAI ACCGGT 2 cut(s) 105, 133
PleI GAGTC 2 cut(s) 89, 175
PpsI GAGTC 2 cut(s) 89, 175
PshAI GACNNNNGTC 1 cut(s) 74
Psp6I CCWGG 1 cut(s) 24
PspEI GGTNACC 1 cut(s) 67
PspGI CCWGG 1 cut(s) 24
PspN4I GGNNCC 1 cut(s) 132
PspPI GGNCC 4 cut(s) 43, 48, 131, 136
PspXI VCTCGAGB 1 cut(s) 164
PsuI RGATCY 1 cut(s) 53
Rsr2I CGGWCCG 2 cut(s) 48, 136
RsrII CGGWCCG 2 cut(s) 48, 136
Sau3AI GATC 1 cut(s) 53
Sau96I GGNCC 4 cut(s) 43, 48, 131, 136
SchI GAGTC 2 cut(s) 90, 176
ScrFI CCNGG 2 cut(s) 26, 140
SetI ASST 5 cut(s) 39, 64, 69, 126, 191
Sfr274I CTCGAG 1 cut(s) 164
SinI GGWCC 3 cut(s) 48, 131, 136
SlaI CTCGAG 1 cut(s) 164
SmlI CTYRAG 1 cut(s) 164
SmoI CTYRAG 1 cut(s) 164
SspMI CTAG 1 cut(s) 57
StyD4I CCNGG 2 cut(s) 24, 138
TaaI ACNGT 1 cut(s) 13
TaiI ACGT 1 cut(s) 126
TaqI TCGA 3 cut(s) 8, 93, 165
TfiI GAWTC 1 cut(s) 5
TseFI GTSAC 1 cut(s) 67
Tsp45I GTSAC 1 cut(s) 67
TspDTI ATGAA 1 cut(s) 100
VpaK11BI GGWCC 3 cut(s) 48, 131, 136
XbaI TCTAGA 1 cut(s) 56
XhoI CTCGAG 1 cut(s) 164
XmnI GAANNNNTTC 1 cut(s) 107
XspI CTAG 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.