Rh1AG208100

ribosomal protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Reverse (-)
39493576 .. 39503090
9515 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG208100.1

Sequence Viewer

Length: 183 bp
ATGAGAAACGTCAAGGGTCATGTCCAGGAGGGCGACACCCTCACCTTGCTCGAGTCCGATAGGGAAGCAAGAAGGCTACGTTGCTGGGTTTTCCTCTTCGTCTTCAACGATGGAAAAGAAAAAAGCTATCCTCGACCTACCTATAGAACCAGACCCGATCTCGATCTCGACCTCAACGATTGA
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

60

Amino Acids

7.18

Weight (kDa)

6.56

Isoelectric Point (pI)

28.41

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S28e PF01200 1 - 26 9.1e-10 Ribosomal protein S28e
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 106
AjnI CCWGG 1 cut(s) 24
AluBI AGCT 1 cut(s) 126
AluI AGCT 1 cut(s) 126
Ama87I CYCGRG 1 cut(s) 50
AsuHPI GGTGA 1 cut(s) 34
AvaI CYCGRG 1 cut(s) 50
BbsI GAAGAC 1 cut(s) 94
BccI CCATC 1 cut(s) 104
BciT130I CCWGG 1 cut(s) 26
BfmI CTRYAG 1 cut(s) 142
Bme1390I CCNGG 1 cut(s) 26
BmeT110I CYCGRG 1 cut(s) 50
BmrFI CCNGG 1 cut(s) 26
BpiI GAAGAC 1 cut(s) 94
BsaBI GATNNNNATC 1 cut(s) 162
Bse8I GATNNNNATC 1 cut(s) 162
BseBI CCWGG 1 cut(s) 26
BseJI GATNNNNATC 1 cut(s) 162
BseYI CCCAGC 1 cut(s) 84
BsiHKCI CYCGRG 1 cut(s) 50
BsoBI CYCGRG 1 cut(s) 50
Bsp143I GATC 2 cut(s) 157, 163
BssMI GATC 2 cut(s) 157, 163
Bst2UI CCWGG 1 cut(s) 26
Bst6I CTCTTC 1 cut(s) 101
BstKTI GATC 2 cut(s) 160, 166
BstMBI GATC 2 cut(s) 157, 163
BstNI CCWGG 1 cut(s) 26
BstSCI CCNGG 1 cut(s) 24
BstSFI CTRYAG 1 cut(s) 142
BstV2I GAAGAC 1 cut(s) 94
CviAII CATG 1 cut(s) 20
CviJI RGCY 2 cut(s) 76, 126
CviKI_1 RGCY 2 cut(s) 76, 126
DpnI GATC 2 cut(s) 159, 165
DpnII GATC 2 cut(s) 157, 163
Eam1104I CTCTTC 1 cut(s) 101
EarI CTCTTC 1 cut(s) 101
Eco88I CYCGRG 1 cut(s) 50
EcoRII CCWGG 1 cut(s) 24
FaeI CATG 1 cut(s) 23
FaiI YATR 2 cut(s) 21, 144
FatI CATG 1 cut(s) 19
GsaI CCCAGC 1 cut(s) 88
Hin1II CATG 1 cut(s) 23
HinfI GANTC 1 cut(s) 53
HphI GGTGA 1 cut(s) 34
Hpy188I TCNGA 1 cut(s) 58
Hpy188III TCNNGA 2 cut(s) 161, 167
HpyAV CCTTC 1 cut(s) 66
HpyCH4IV ACGT 2 cut(s) 9, 79
HpySE526I ACGT 2 cut(s) 9, 79
Hsp92II CATG 1 cut(s) 23
Kzo9I GATC 2 cut(s) 157, 163
LpnPI CCDG 4 cut(s) 11, 38, 70, 163
MaeII ACGT 2 cut(s) 9, 79
MalI GATC 2 cut(s) 159, 165
MboI GATC 2 cut(s) 157, 163
MboII GAAGA 2 cut(s) 88, 94
MlyI GAGTC 1 cut(s) 62
MnlI CCTC 5 cut(s) 22, 50, 104, 141, 182
MspR9I CCNGG 1 cut(s) 26
MvaI CCWGG 1 cut(s) 26
NdeII GATC 2 cut(s) 157, 163
NlaIII CATG 1 cut(s) 23
PaeR7I CTCGAG 1 cut(s) 50
PcsI WCGNNNNNNNCGW 2 cut(s) 105, 174
PfoI TCCNGGA 1 cut(s) 24
PleI GAGTC 1 cut(s) 61
PpsI GAGTC 1 cut(s) 61
Psp6I CCWGG 1 cut(s) 24
PspFI CCCAGC 1 cut(s) 84
PspGI CCWGG 1 cut(s) 24
PspXI VCTCGAGB 1 cut(s) 50
Sau3AI GATC 2 cut(s) 157, 163
SchI GAGTC 1 cut(s) 62
ScrFI CCNGG 1 cut(s) 26
SetI ASST 7 cut(s) 12, 47, 82, 128, 139, 143, 174
SfcI CTRYAG 1 cut(s) 142
Sfr274I CTCGAG 1 cut(s) 50
SlaI CTCGAG 1 cut(s) 50
SmlI CTYRAG 1 cut(s) 50
SmoI CTYRAG 1 cut(s) 50
StyD4I CCNGG 1 cut(s) 24
TaiI ACGT 2 cut(s) 12, 82
TaqI TCGA 4 cut(s) 51, 133, 162, 168
XhoI CTCGAG 1 cut(s) 50
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.