Rmu_sc0001616.1_g000042

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001616.1
Physical Location & Seq
Reverse (-)
213314 .. 214215
902 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001616.1_g000042.1.cds

Sequence Viewer

Length: 657 bp
atgtgcttttggagagcctacaatgatctcctgccaatcaaagaagctttgacaaagaaaggtttacaagtagacacaagctgccttctgtgtctggcgaggtttgaagaccgtgagcatgttttctgcaaatgccctatcgcacaaattgttctaacagctcgtcctcttgatcttagtggaagtctgcttaccaatatcaatttcaaggaatggtgtctagaccatgcagtcaacttgcagcaagataagtttgaaaaattaatgatgattttatggactctatggaaggacaggaataacaaattttggaagggcacagttcagagcttcattcctaatcaaaccaaaggtggaatcggtggtgtgctatgtgatgaacatggcaactttaaagcagcttttgctttgcctgttcgaaatattgcagcagctaagcatgtggagcttctagcggtgaaacaaggcgtgcaatttctccagtccttcccaaaccagggcattcaatcagaatgccttgaggccatcaatgatattgcaaaccaagctcacaggttagctagtctagcttttgatgagaattgtagtgctatttggtatgttgtacctccagattgcattctggacgtgttgaactcagattgtactaaaccttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

218

Amino Acids

24.58

Weight (kDa)

6.51

Isoelectric Point (pI)

37.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 230
AccI GTMKAC 1 cut(s) 72
AciI CCGC 1 cut(s) 455
AcsI RAATTY 1 cut(s) 305
AfaI GTAC 2 cut(s) 606, 646
AfiI CCNNNNNNNGG 2 cut(s) 496, 497
AflIII ACRYGT 1 cut(s) 627
AgsI TTSAA 5 cut(s) 107, 208, 257, 506, 634
AjiI CACGTC 1 cut(s) 628
AjnI CCWGG 1 cut(s) 495
AjuI GAANNNNNNNTTGG 2 cut(s) 188, 220
AoxI GGCC 1 cut(s) 522
ApeKI GCWGC 5 cut(s) 81, 241, 398, 428, 431
ApoI RAATTY 1 cut(s) 305
AseI ATTAAT 1 cut(s) 263
AsuHPI GGTGA 1 cut(s) 469
AsuII TTCGAA 1 cut(s) 418
BaeGI GKGCMC 1 cut(s) 320
BarI GAAGNNNNNNTAC 2 cut(s) 175, 207
BbsI GAAGAC 1 cut(s) 114
BbvI GCAGC 5 cut(s) 68, 253, 410, 440, 443
BccI CCATC 1 cut(s) 533
BciT130I CCWGG 1 cut(s) 497
BfaI CTAG 4 cut(s) 221, 452, 561, 566
BisI GCNGC 5 cut(s) 82, 242, 399, 429, 432
BlpI GCTNAGC 1 cut(s) 435
BlsI GCNGC 5 cut(s) 83, 243, 400, 430, 433
Bme1390I CCNGG 1 cut(s) 497
BmgBI CACGTC 1 cut(s) 628
BmrFI CCNGG 1 cut(s) 497
BpiI GAAGAC 1 cut(s) 114
BpmI CTGGAG 2 cut(s) 464, 594
Bpu1102I GCTNAGC 1 cut(s) 435
Bpu14I TTCGAA 1 cut(s) 418
BpuEI CTTGAG 1 cut(s) 539
BsaJI CCNNGG 1 cut(s) 496
Bsc4I CCNNNNNNNGG 2 cut(s) 496, 497
Bse1I ACTGG 1 cut(s) 481
BseBI CCWGG 1 cut(s) 497
BseDI CCNNGG 1 cut(s) 496
BseLI CCNNNNNNNGG 2 cut(s) 496, 497
BseMII CTCAG 1 cut(s) 651
BseNI ACTGG 1 cut(s) 481
BseSI GKGCMC 1 cut(s) 320
BseXI GCAGC 5 cut(s) 68, 253, 410, 440, 443
BshFI GGCC 1 cut(s) 524
BslI CCNNNNNNNGG 2 cut(s) 496, 497
BsmI GAATGC 3 cut(s) 501, 518, 618
BsnI GGCC 1 cut(s) 524
Bsp119I TTCGAA 1 cut(s) 418
Bsp1286I GDGCHC 1 cut(s) 320
Bsp143I GATC 2 cut(s) 25, 172
Bsp1720I GCTNAGC 1 cut(s) 435
BspACI CCGC 1 cut(s) 455
BspANI GGCC 1 cut(s) 524
BspCNI CTCAG 1 cut(s) 650
BspT104I TTCGAA 1 cut(s) 418
BsrI ACTGG 1 cut(s) 481
BssECI CCNNGG 1 cut(s) 496
BssMI GATC 2 cut(s) 25, 172
Bst2UI CCWGG 1 cut(s) 497
Bst4CI ACNGT 2 cut(s) 113, 322
BstAPI GCANNNNNTGC 1 cut(s) 404
BstBI TTCGAA 1 cut(s) 418
BstC8I GCNNGC 1 cut(s) 470
BstDEI CTNAG 3 cut(s) 176, 435, 637
BstKTI GATC 2 cut(s) 28, 175
BstMBI GATC 2 cut(s) 25, 172
BstMWI GCNNNNNNNGC 4 cut(s) 404, 445, 545, 566
BstNI CCWGG 1 cut(s) 497
BstNSI RCATGY 2 cut(s) 122, 443
BstSCI CCNGG 1 cut(s) 495
BstSLI GKGCMC 1 cut(s) 320
BstV1I GCAGC 5 cut(s) 68, 253, 410, 440, 443
BstV2I GAAGAC 1 cut(s) 114
BsuRI GGCC 1 cut(s) 524
BtrI CACGTC 1 cut(s) 628
Cac8I GCNNGC 1 cut(s) 470
Csp6I GTAC 2 cut(s) 605, 645
CviAII CATG 4 cut(s) 119, 227, 383, 440
CviQI GTAC 2 cut(s) 605, 645
DdeI CTNAG 3 cut(s) 176, 435, 637
DpnI GATC 2 cut(s) 27, 174
DpnII GATC 2 cut(s) 25, 172
DraI TTTAAA 1 cut(s) 394
DrdI GACNNNNNNGTC 1 cut(s) 230
DseDI GACNNNNNNGTC 1 cut(s) 230
EcoRII CCWGG 1 cut(s) 495
FaeI CATG 4 cut(s) 122, 230, 386, 443
FaiI YATR 8 cut(s) 120, 228, 277, 286, 373, 384, 441, 600
FatI CATG 4 cut(s) 118, 226, 382, 439
FblI GTMKAC 1 cut(s) 72
Fnu4HI GCNGC 5 cut(s) 82, 242, 399, 429, 432
Fsp4HI GCNGC 5 cut(s) 82, 242, 399, 429, 432
FspBI CTAG 4 cut(s) 221, 452, 561, 566
GluI GCNGC 5 cut(s) 82, 242, 399, 429, 432
GsuI CTGGAG 2 cut(s) 464, 594
HaeIII GGCC 1 cut(s) 524
Hin1II CATG 4 cut(s) 122, 230, 386, 443
HincII GTYRAC 1 cut(s) 235
HindII GTYRAC 1 cut(s) 235
HindIII AAGCTT 1 cut(s) 45
HinfI GANTC 2 cut(s) 280, 357
HphI GGTGA 1 cut(s) 469
Hpy166II GTNNAC 3 cut(s) 65, 73, 235
Hpy188I TCNGA 3 cut(s) 327, 511, 640
Hpy188III TCNNGA 4 cut(s) 170, 221, 611, 623
Hpy8I GTNNAC 3 cut(s) 65, 73, 235
HpyAV CCTTC 4 cut(s) 95, 283, 307, 496
HpyCH4III ACNGT 2 cut(s) 113, 322
HpyCH4IV ACGT 1 cut(s) 627
HpyCH4V TGCA 7 cut(s) 129, 230, 241, 428, 472, 539, 618
HpyF10VI GCNNNNNNNGC 4 cut(s) 404, 445, 545, 566
HpyF3I CTNAG 3 cut(s) 176, 435, 637
HpySE526I ACGT 1 cut(s) 627
Hsp92II CATG 4 cut(s) 122, 230, 386, 443
Kzo9I GATC 2 cut(s) 25, 172
LmnI GCTCC 1 cut(s) 445
Lsp1109I GCAGC 5 cut(s) 68, 253, 410, 440, 443
MaeI CTAG 4 cut(s) 221, 452, 561, 566
MaeII ACGT 1 cut(s) 627
MalI GATC 2 cut(s) 27, 174
MboI GATC 2 cut(s) 25, 172
MboII GAAGA 1 cut(s) 119
MhlI GDGCHC 1 cut(s) 320
MluCI AATT 6 cut(s) 147, 202, 260, 305, 473, 580
MlyI GAGTC 1 cut(s) 274
MnlI CCTC 4 cut(s) 93, 177, 514, 618
MseI TTAA 2 cut(s) 263, 393
MspR9I CCNGG 1 cut(s) 497
Mva1269I GAATGC 3 cut(s) 501, 518, 618
MvaI CCWGG 1 cut(s) 497
MwoI GCNNNNNNNGC 4 cut(s) 404, 445, 545, 566
NdeII GATC 2 cut(s) 25, 172
NlaIII CATG 4 cut(s) 122, 230, 386, 443
NspI RCATGY 2 cut(s) 122, 443
NspV TTCGAA 1 cut(s) 418
PctI GAATGC 3 cut(s) 501, 518, 618
PfeI GAWTC 1 cut(s) 357
PkrI GCNGC 5 cut(s) 83, 243, 400, 430, 433
PleI GAGTC 1 cut(s) 274
PpsI GAGTC 1 cut(s) 274
PshBI ATTAAT 1 cut(s) 263
Psp6I CCWGG 1 cut(s) 495
PspGI CCWGG 1 cut(s) 495
RsaI GTAC 2 cut(s) 606, 646
RsaNI GTAC 2 cut(s) 605, 645
SaqAI TTAA 2 cut(s) 263, 393
SatI GCNGC 5 cut(s) 82, 242, 399, 429, 432
Sau3AI GATC 2 cut(s) 25, 172
SchI GAGTC 1 cut(s) 274
ScrFI CCNGG 1 cut(s) 497
SduI GDGCHC 1 cut(s) 320
SfuI TTCGAA 1 cut(s) 418
SmlI CTYRAG 1 cut(s) 518
SmoI CTYRAG 1 cut(s) 518
Sse9I AATT 6 cut(s) 147, 202, 260, 305, 473, 580
SsiI CCGC 1 cut(s) 455
SspI AATATT 1 cut(s) 424
SspMI CTAG 4 cut(s) 221, 452, 561, 566
StyD4I CCNGG 1 cut(s) 495
TaaI ACNGT 2 cut(s) 113, 322
TaiI ACGT 1 cut(s) 630
TaqI TCGA 1 cut(s) 418
TasI AATT 6 cut(s) 147, 202, 260, 305, 473, 580
TatI WGTACW 1 cut(s) 644
TfiI GAWTC 1 cut(s) 357
Tru1I TTAA 2 cut(s) 263, 393
Tru9I TTAA 2 cut(s) 263, 393
TseI GCWGC 5 cut(s) 81, 241, 398, 428, 431
TspDTI ATGAA 2 cut(s) 322, 393
VspI ATTAAT 1 cut(s) 263
XapI RAATTY 1 cut(s) 305
XbaI TCTAGA 1 cut(s) 220
XceI RCATGY 2 cut(s) 122, 443
XmiI GTMKAC 1 cut(s) 72
XspI CTAG 4 cut(s) 221, 452, 561, 566
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.