Rorug03G0189600

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Forward (+)
16537867 .. 16538250
384 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0189600.1

Sequence Viewer

Length: 384 bp
ATGCAAATGATTCAGTGGACTATCAAGCAGATGGAGGAGTATCATAGTATTCATCCCAAGTTGGGTATAAAGAAGAAAAGAGAGGTGACGAAGTGGCTGAACCCTTCAACTGGTAGGCTAAAAATTAATTTTGATGGTGCTTTTAAGGTGGAAAGTGGGTGTGGTGGTATTGGTGTAGTAGTTATAGATAGTATGGGGAGGAGTGTCGTAGCAATGGCTAGACCTTTTGTACATGCACATTTAGTTCTAAATATGGAGGCTGAAGCGTGTAGAGCTGGTCTTCTTCTTGGTATTTACCATGGTCGGATGAAATTAGATATTGAGAGTGACTCTGTCCTTTTAATTACTGCACTTCAGAGTGAGGAGAAGAATTCTTGGAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

127

Amino Acids

14.28

Weight (kDa)

9.23

Isoelectric Point (pI)

40.05

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_3 PF13456 43 - 124 2.2e-11 Reverse transcriptase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 370
AcuI CTGAAG 2 cut(s) 282, 338
AfaI GTAC 1 cut(s) 231
AfiI CCNNNNNNNGG 2 cut(s) 62, 110
AgsI TTSAA 1 cut(s) 108
AluBI AGCT 1 cut(s) 275
AluI AGCT 1 cut(s) 275
ApoI RAATTY 1 cut(s) 370
AseI ATTAAT 1 cut(s) 126
AsuHPI GGTGA 1 cut(s) 97
BbsI GAAGAC 1 cut(s) 272
BccI CCATC 2 cut(s) 25, 128
BfaI CTAG 1 cut(s) 219
BpiI GAAGAC 1 cut(s) 272
BplI GAGNNNNNCTC 2 cut(s) 314, 346
BsaJI CCNNGG 1 cut(s) 298
Bsc4I CCNNNNNNNGG 2 cut(s) 62, 110
Bse1I ACTGG 1 cut(s) 115
Bse3DI GCAATG 1 cut(s) 219
BseDI CCNNGG 1 cut(s) 298
BseGI GGATG 2 cut(s) 52, 312
BseLI CCNNNNNNNGG 2 cut(s) 62, 110
BseMI GCAATG 1 cut(s) 219
BseNI ACTGG 1 cut(s) 115
BseRI GAGGAG 3 cut(s) 50, 214, 377
BsgI GTGCAG 1 cut(s) 333
BslI CCNNNNNNNGG 2 cut(s) 62, 110
Bsp1407I TGTACA 1 cut(s) 229
Bsp19I CCATGG 1 cut(s) 298
BsrDI GCAATG 1 cut(s) 219
BsrGI TGTACA 1 cut(s) 229
BsrI ACTGG 1 cut(s) 115
BssECI CCNNGG 1 cut(s) 298
BssT1I CCWWGG 1 cut(s) 298
BstAUI TGTACA 1 cut(s) 229
BstDSI CCRYGG 1 cut(s) 298
BstF5I GGATG 2 cut(s) 52, 312
BstMWI GCNNNNNNNGC 1 cut(s) 272
BstNSI RCATGY 1 cut(s) 236
BstV2I GAAGAC 1 cut(s) 272
BtgI CCRYGG 1 cut(s) 298
BtsCI GGATG 2 cut(s) 52, 312
BtsIMutI CAGTG 1 cut(s) 20
Csp6I GTAC 1 cut(s) 230
CviAII CATG 2 cut(s) 233, 299
CviJI RGCY 5 cut(s) 97, 118, 218, 260, 275
CviKI_1 RGCY 5 cut(s) 97, 118, 218, 260, 275
CviQI GTAC 1 cut(s) 230
Eco130I CCWWGG 1 cut(s) 298
Eco57I CTGAAG 2 cut(s) 282, 338
EcoRI GAATTC 1 cut(s) 370
EcoT14I CCWWGG 1 cut(s) 298
ErhI CCWWGG 1 cut(s) 298
FaeI CATG 2 cut(s) 236, 302
FaiI YATR 7 cut(s) 45, 68, 185, 194, 234, 254, 300
FatI CATG 2 cut(s) 232, 298
FokI GGATG 2 cut(s) 39, 319
FspBI CTAG 1 cut(s) 219
Hin1II CATG 2 cut(s) 236, 302
HinfI GANTC 2 cut(s) 10, 329
HphI GGTGA 1 cut(s) 97
Hpy166II GTNNAC 1 cut(s) 18
Hpy188I TCNGA 2 cut(s) 306, 357
Hpy8I GTNNAC 1 cut(s) 18
HpyAV CCTTC 1 cut(s) 114
HpyCH4V TGCA 3 cut(s) 4, 236, 350
HpyF10VI GCNNNNNNNGC 1 cut(s) 272
Hsp92II CATG 2 cut(s) 236, 302
LpnPI CCDG 2 cut(s) 96, 261
MaeI CTAG 1 cut(s) 219
MaeIII GTNAC 2 cut(s) 85, 326
MboII GAAGA 4 cut(s) 85, 272, 275, 379
MluCI AATT 5 cut(s) 123, 127, 311, 342, 370
MlyI GAGTC 1 cut(s) 323
MmeI TCCRAC 1 cut(s) 284
MnlI CCTC 6 cut(s) 28, 76, 192, 250, 355, 372
MseI TTAA 3 cut(s) 126, 144, 341
MwoI GCNNNNNNNGC 1 cut(s) 272
NcoI CCATGG 1 cut(s) 298
NlaIII CATG 2 cut(s) 236, 302
NmuCI GTSAC 2 cut(s) 85, 326
NspI RCATGY 1 cut(s) 236
PfeI GAWTC 1 cut(s) 10
PflFI GACNNNGTC 1 cut(s) 332
PleI GAGTC 1 cut(s) 323
PpsI GAGTC 1 cut(s) 323
PshBI ATTAAT 1 cut(s) 126
PsyI GACNNNGTC 1 cut(s) 332
RsaI GTAC 1 cut(s) 231
RsaNI GTAC 1 cut(s) 230
SaqAI TTAA 3 cut(s) 126, 144, 341
SchI GAGTC 1 cut(s) 323
SetI ASST 5 cut(s) 87, 150, 226, 277, 383
SgeI CNNG 9 cut(s) 37, 70, 123, 231, 245, 279, 288, 299, 311
Sse9I AATT 5 cut(s) 123, 127, 311, 342, 370
SspMI CTAG 1 cut(s) 219
StyI CCWWGG 1 cut(s) 298
TasI AATT 5 cut(s) 123, 127, 311, 342, 370
TatI WGTACW 1 cut(s) 229
TfiI GAWTC 1 cut(s) 10
Tru1I TTAA 3 cut(s) 126, 144, 341
Tru9I TTAA 3 cut(s) 126, 144, 341
TscAI CASTG 1 cut(s) 20
TseFI GTSAC 2 cut(s) 85, 326
Tsp45I GTSAC 2 cut(s) 85, 326
TspDTI ATGAA 2 cut(s) 41, 323
TspRI CASTG 1 cut(s) 20
Tth111I GACNNNGTC 1 cut(s) 332
VspI ATTAAT 1 cut(s) 126
XapI RAATTY 1 cut(s) 370
XceI RCATGY 1 cut(s) 236
XspI CTAG 1 cut(s) 219
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.