Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001616.1

Orthogroup ID

OG0002539

Physical Location & Seq

Genomic Coordinates Reverse (-)

216529 .. 217430

Gene Structure 902 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001616.1_g000043.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 657 bp

atgtgcttttggagagcctacaatgatctcctgccaatcaaagaagctttgacaaagaaaggtttacaagtagacacaagctgccttctgtgtctggcgaggtttgaagaccgtgagcatgttttctgcaaatgccctatcgcacaaattgttctaacagctcgtcctcttgatcttagtggaagtctgcttaccaatatcaatttcaaggaatggtgtctagaccatgcagtcaacttgcagcaagataagtttgaaaaattaatgatgattttatggactctatggaaggacaggaataacaaattttggaagggcacagttcagagcttcattcctaatcaaaccaaaggtggaatcggtggtgtgctatgtgatgaacatggcaactttaaagcagcttttgctttgcctgttcgaaatattgcagcagctaagcatgtggagcttctagcggtgaaacaaggcgtgcaatttctgcagtccttcccaaacaagggcattcaatcagaatgccttgaggccatcaatgatattgcaaaccaagctcacaggttagctagtctagcttttgatgagaattgtagtgctatttggtatgttgtacctccagattgcattctggacgtgttgaactcagattgtactaaaccttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RVT_1 RVT_3 zf-RVT

Protein Analysis

218

Amino Acids

24.58

Weight (kDa)

6.92

Isoelectric Point (pI)

38.84

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002539)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g19763
pyrus_communis	pycom11g21530
rosa_chinensis	RchiOBHm_Chr3g0477221 RchiOBHm_Chr5g0044911
rosa_laevigata	RLG00000002565
rosa_multiflora	Rmu_co8232993.1_g000001 Rmu_sc0000841.1_g000006 Rmu_sc0000957.1_g000002 Rmu_sc0001035.1_g000054 Rmu_sc0001616.1_g000042 Rmu_sc0001616.1_g000043 Rmu_sc0001911.1_g000006 Rmu_sc0002195.1_g000001 Rmu_sc0002407.1_g000016 Rmu_sc0002854.1_g000009 Rmu_sc0003722.1_g000038 Rmu_sc0004084.1_g000060 Rmu_sc0005693.1_g000013 Rmu_sc0006255.1_g000005 Rmu_sc0006591.1_g000003 Rmu_sc0007409.1_g000001 Rmu_sc0007793.1_g000004 Rmu_sc0009420.1_g000001 Rmu_sc0010368.1_g000005 Rmu_sc0010867.1_g000001 Rmu_ssc0000432.1_g000012
rosa_roxburghii	Rroxscaffold_3G00243150
rosa_rugosa	Rorug01G0183800 Rorug03G0046000 Rorug03G0189600 Rorug03G0283000 Rorug03G0330400 Rorug04G0001200 Rorug04G0105000 Rorug04G0142500 Rorug05G0219200 Rorug05G0240300 Rorug05G0266300 Rorug05G0507900 Rorug07G0104400 Rorug07G0113800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	230
AccI	GTMKAC	1 cut(s)	72
AciI	CCGC	1 cut(s)	455
AcsI	RAATTY	1 cut(s)	305
AfaI	GTAC	2 cut(s)	606, 646
AfiI	CCNNNNNNNGG	2 cut(s)	496, 497
AflIII	ACRYGT	1 cut(s)	627
AgsI	TTSAA	5 cut(s)	107, 208, 257, 506, 634
AjiI	CACGTC	1 cut(s)	628
AjuI	GAANNNNNNNTTGG	2 cut(s)	188, 220
AoxI	GGCC	1 cut(s)	522
ApeKI	GCWGC	5 cut(s)	81, 241, 398, 428, 431
ApoI	RAATTY	1 cut(s)	305
AseI	ATTAAT	1 cut(s)	263
AsuHPI	GGTGA	1 cut(s)	469
AsuII	TTCGAA	1 cut(s)	418
BaeGI	GKGCMC	1 cut(s)	320
BarI	GAAGNNNNNNTAC	2 cut(s)	175, 207
BbsI	GAAGAC	1 cut(s)	114
BbvI	GCAGC	5 cut(s)	68, 253, 410, 440, 443
BccI	CCATC	1 cut(s)	533
BfaI	CTAG	4 cut(s)	221, 452, 561, 566
BfmI	CTRYAG	1 cut(s)	479
BisI	GCNGC	5 cut(s)	82, 242, 399, 429, 432
BlpI	GCTNAGC	1 cut(s)	435
BlsI	GCNGC	5 cut(s)	83, 243, 400, 430, 433
BmgBI	CACGTC	1 cut(s)	628
BpiI	GAAGAC	1 cut(s)	114
BpmI	CTGGAG	1 cut(s)	594
Bpu1102I	GCTNAGC	1 cut(s)	435
Bpu14I	TTCGAA	1 cut(s)	418
BpuEI	CTTGAG	1 cut(s)	539
Bsc4I	CCNNNNNNNGG	2 cut(s)	496, 497
BseLI	CCNNNNNNNGG	2 cut(s)	496, 497
BseMII	CTCAG	1 cut(s)	651
BseSI	GKGCMC	1 cut(s)	320
BseXI	GCAGC	5 cut(s)	68, 253, 410, 440, 443
BshFI	GGCC	1 cut(s)	524
BslI	CCNNNNNNNGG	2 cut(s)	496, 497
BsmI	GAATGC	3 cut(s)	501, 518, 618
BsnI	GGCC	1 cut(s)	524
Bsp119I	TTCGAA	1 cut(s)	418
Bsp1286I	GDGCHC	1 cut(s)	320
Bsp143I	GATC	2 cut(s)	25, 172
Bsp1720I	GCTNAGC	1 cut(s)	435
BspACI	CCGC	1 cut(s)	455
BspANI	GGCC	1 cut(s)	524
BspCNI	CTCAG	1 cut(s)	650
BspMAI	CTGCAG	1 cut(s)	483
BspT104I	TTCGAA	1 cut(s)	418
BssMI	GATC	2 cut(s)	25, 172
Bst4CI	ACNGT	2 cut(s)	113, 322
BstAPI	GCANNNNNTGC	2 cut(s)	404, 478
BstBI	TTCGAA	1 cut(s)	418
BstC8I	GCNNGC	1 cut(s)	470
BstDEI	CTNAG	3 cut(s)	176, 435, 637
BstKTI	GATC	2 cut(s)	28, 175
BstMBI	GATC	2 cut(s)	25, 172
BstMWI	GCNNNNNNNGC	5 cut(s)	404, 445, 478, 545, 566
BstNSI	RCATGY	2 cut(s)	122, 443
BstSFI	CTRYAG	1 cut(s)	479
BstSLI	GKGCMC	1 cut(s)	320
BstV1I	GCAGC	5 cut(s)	68, 253, 410, 440, 443
BstV2I	GAAGAC	1 cut(s)	114
BsuRI	GGCC	1 cut(s)	524
BtrI	CACGTC	1 cut(s)	628
Cac8I	GCNNGC	1 cut(s)	470
Csp6I	GTAC	2 cut(s)	605, 645
CviAII	CATG	4 cut(s)	119, 227, 383, 440
CviQI	GTAC	2 cut(s)	605, 645
DdeI	CTNAG	3 cut(s)	176, 435, 637
DpnI	GATC	2 cut(s)	27, 174
DpnII	GATC	2 cut(s)	25, 172
DraI	TTTAAA	1 cut(s)	394
DrdI	GACNNNNNNGTC	1 cut(s)	230
DseDI	GACNNNNNNGTC	1 cut(s)	230
FaeI	CATG	4 cut(s)	122, 230, 386, 443
FaiI	YATR	8 cut(s)	120, 228, 277, 286, 373, 384, 441, 600
FatI	CATG	4 cut(s)	118, 226, 382, 439
FblI	GTMKAC	1 cut(s)	72
Fnu4HI	GCNGC	5 cut(s)	82, 242, 399, 429, 432
Fsp4HI	GCNGC	5 cut(s)	82, 242, 399, 429, 432
FspBI	CTAG	4 cut(s)	221, 452, 561, 566
GluI	GCNGC	5 cut(s)	82, 242, 399, 429, 432
GsuI	CTGGAG	1 cut(s)	594
HaeIII	GGCC	1 cut(s)	524
Hin1II	CATG	4 cut(s)	122, 230, 386, 443
HincII	GTYRAC	1 cut(s)	235
HindII	GTYRAC	1 cut(s)	235
HindIII	AAGCTT	1 cut(s)	45
HinfI	GANTC	2 cut(s)	280, 357
HphI	GGTGA	1 cut(s)	469
Hpy166II	GTNNAC	3 cut(s)	65, 73, 235
Hpy188I	TCNGA	3 cut(s)	327, 511, 640
Hpy188III	TCNNGA	4 cut(s)	170, 221, 611, 623
Hpy8I	GTNNAC	3 cut(s)	65, 73, 235
HpyAV	CCTTC	4 cut(s)	95, 283, 307, 496
HpyCH4III	ACNGT	2 cut(s)	113, 322
HpyCH4IV	ACGT	1 cut(s)	627
HpyCH4V	TGCA	8 cut(s)	129, 230, 241, 428, 472, 481, 539, 618
HpyF10VI	GCNNNNNNNGC	5 cut(s)	404, 445, 478, 545, 566
HpyF3I	CTNAG	3 cut(s)	176, 435, 637
HpySE526I	ACGT	1 cut(s)	627
Hsp92II	CATG	4 cut(s)	122, 230, 386, 443
Kzo9I	GATC	2 cut(s)	25, 172
LmnI	GCTCC	1 cut(s)	445
LpnPI	CCDG	7 cut(s)	44, 80, 280, 426, 538, 608, 624
Lsp1109I	GCAGC	5 cut(s)	68, 253, 410, 440, 443
MaeI	CTAG	4 cut(s)	221, 452, 561, 566
MaeII	ACGT	1 cut(s)	627
MalI	GATC	2 cut(s)	27, 174
MboI	GATC	2 cut(s)	25, 172
MboII	GAAGA	1 cut(s)	119
MhlI	GDGCHC	1 cut(s)	320
MluCI	AATT	6 cut(s)	147, 202, 260, 305, 473, 580
MlyI	GAGTC	1 cut(s)	274
MnlI	CCTC	4 cut(s)	93, 177, 514, 618
MseI	TTAA	2 cut(s)	263, 393
Mva1269I	GAATGC	3 cut(s)	501, 518, 618
MwoI	GCNNNNNNNGC	5 cut(s)	404, 445, 478, 545, 566
NdeII	GATC	2 cut(s)	25, 172
NlaIII	CATG	4 cut(s)	122, 230, 386, 443
NspI	RCATGY	2 cut(s)	122, 443
NspV	TTCGAA	1 cut(s)	418
PctI	GAATGC	3 cut(s)	501, 518, 618
PfeI	GAWTC	1 cut(s)	357
PkrI	GCNGC	5 cut(s)	83, 243, 400, 430, 433
PleI	GAGTC	1 cut(s)	274
PpsI	GAGTC	1 cut(s)	274
PshBI	ATTAAT	1 cut(s)	263
PstI	CTGCAG	1 cut(s)	483
RsaI	GTAC	2 cut(s)	606, 646
RsaNI	GTAC	2 cut(s)	605, 645
SaqAI	TTAA	2 cut(s)	263, 393
SatI	GCNGC	5 cut(s)	82, 242, 399, 429, 432
Sau3AI	GATC	2 cut(s)	25, 172
SchI	GAGTC	1 cut(s)	274
SduI	GDGCHC	1 cut(s)	320
SfcI	CTRYAG	1 cut(s)	479
SfuI	TTCGAA	1 cut(s)	418
SmlI	CTYRAG	1 cut(s)	518
SmoI	CTYRAG	1 cut(s)	518
Sse9I	AATT	6 cut(s)	147, 202, 260, 305, 473, 580
SsiI	CCGC	1 cut(s)	455
SspI	AATATT	1 cut(s)	424
SspMI	CTAG	4 cut(s)	221, 452, 561, 566
TaaI	ACNGT	2 cut(s)	113, 322
TaiI	ACGT	1 cut(s)	630
TaqI	TCGA	1 cut(s)	418
TasI	AATT	6 cut(s)	147, 202, 260, 305, 473, 580
TatI	WGTACW	1 cut(s)	644
TfiI	GAWTC	1 cut(s)	357
Tru1I	TTAA	2 cut(s)	263, 393
Tru9I	TTAA	2 cut(s)	263, 393
TseI	GCWGC	5 cut(s)	81, 241, 398, 428, 431
TspDTI	ATGAA	2 cut(s)	322, 393
VspI	ATTAAT	1 cut(s)	263
XapI	RAATTY	1 cut(s)	305
XbaI	TCTAGA	1 cut(s)	220
XceI	RCATGY	2 cut(s)	122, 443
XmiI	GTMKAC	1 cut(s)	72
XspI	CTAG	4 cut(s)	221, 452, 561, 566

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.