Rmu_sc0004084.1_g000060

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004084.1
OG0002539
Physical Location & Seq
Reverse (-)
299322 .. 299747
426 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004084.1_g000060.1.cds

Sequence Viewer

Length: 426 bp
atggaggtaatgccgcaggttctagcttccacttcatctggagacccttacaaggaattgtggcgtagcatctggaaggccagggtttcgggcaaagttagtatttgtgtgtggagggcatgcaacaatctccttgctacaaaacaccgcttacttactaagggttacacaggagaagttcattgtcttttgtgccctcatggcttggagaacacatctcatcttttttgccaatgtcctctagcctcagatattctgtccgtaactccttttcatcttggaaatgaattgtgttcagtctcaaatttcaaagactgcatgcttgatcgggctcttacattaagtggtgatgtgtttgccaaactaatgatgattctctgggcactttggaagaacagaaataacttgttgtggaatggctcatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 zf-RVT

Protein Analysis

141

Amino Acids

15.87

Weight (kDa)

8.68

Isoelectric Point (pI)

26.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 7
AciI CCGC 2 cut(s) 14, 148
AcsI RAATTY 1 cut(s) 304
AfiI CCNNNNNNNGG 1 cut(s) 52
AgsI TTSAA 1 cut(s) 310
AjnI CCWGG 1 cut(s) 80
AluBI AGCT 1 cut(s) 26
AluI AGCT 1 cut(s) 26
Alw26I GTCTC 2 cut(s) 36, 304
AoxI GGCC 1 cut(s) 78
ApoI RAATTY 1 cut(s) 304
AsuHPI GGTGA 1 cut(s) 359
BaeGI GKGCMC 2 cut(s) 197, 385
BanII GRGCYC 1 cut(s) 334
BciT130I CCWGG 1 cut(s) 82
BcoDI GTCTC 2 cut(s) 36, 304
BfaI CTAG 2 cut(s) 23, 242
BfuAI ACCTGC 1 cut(s) 7
BglI GCCNNNNNGGC 1 cut(s) 201
BisI GCNGC 1 cut(s) 14
BlsI GCNGC 1 cut(s) 15
Bme1390I CCNGG 1 cut(s) 82
BmrFI CCNGG 1 cut(s) 82
BmsI GCATC 1 cut(s) 78
BpmI CTGGAG 1 cut(s) 60
BsaI GGTCTC 1 cut(s) 36
BsaJI CCNNGG 1 cut(s) 81
Bsc4I CCNNNNNNNGG 1 cut(s) 52
BseBI CCWGG 1 cut(s) 82
BseDI CCNNGG 1 cut(s) 81
BseLI CCNNNNNNNGG 1 cut(s) 52
BseMII CTCAG 1 cut(s) 261
BseSI GKGCMC 2 cut(s) 197, 385
BshFI GGCC 1 cut(s) 80
BslI CCNNNNNNNGG 1 cut(s) 52
BsmAI GTCTC 2 cut(s) 36, 304
BsnI GGCC 1 cut(s) 80
Bso31I GGTCTC 1 cut(s) 36
Bsp1286I GDGCHC 3 cut(s) 197, 334, 385
Bsp143I GATC 1 cut(s) 325
BspACI CCGC 2 cut(s) 14, 148
BspANI GGCC 1 cut(s) 80
BspCNI CTCAG 1 cut(s) 260
BspMI ACCTGC 1 cut(s) 7
BspTNI GGTCTC 1 cut(s) 36
BssECI CCNNGG 1 cut(s) 81
BssMI GATC 1 cut(s) 325
Bst2UI CCWGG 1 cut(s) 82
BstC8I GCNNGC 2 cut(s) 121, 320
BstDEI CTNAG 2 cut(s) 159, 247
BstKTI GATC 1 cut(s) 328
BstMAI GTCTC 2 cut(s) 36, 304
BstMBI GATC 1 cut(s) 325
BstMWI GCNNNNNNNGC 1 cut(s) 201
BstNI CCWGG 1 cut(s) 82
BstNSI RCATGY 2 cut(s) 123, 322
BstSCI CCNGG 1 cut(s) 80
BstSLI GKGCMC 2 cut(s) 197, 385
BsuRI GGCC 1 cut(s) 80
BveI ACCTGC 1 cut(s) 7
Cac8I GCNNGC 2 cut(s) 121, 320
CviAII CATG 3 cut(s) 120, 200, 319
CviJI RGCY 6 cut(s) 26, 80, 204, 245, 332, 420
CviKI_1 RGCY 6 cut(s) 26, 80, 204, 245, 332, 420
DdeI CTNAG 2 cut(s) 159, 247
DpnI GATC 1 cut(s) 327
DpnII GATC 1 cut(s) 325
Eco24I GRGCYC 1 cut(s) 334
Eco31I GGTCTC 1 cut(s) 36
EcoRII CCWGG 1 cut(s) 80
EcoT38I GRGCYC 1 cut(s) 334
FaeI CATG 3 cut(s) 123, 203, 322
FaiI YATR 4 cut(s) 121, 201, 320, 424
FatI CATG 3 cut(s) 119, 199, 318
Fnu4HI GCNGC 1 cut(s) 14
FriOI GRGCYC 1 cut(s) 334
Fsp4HI GCNGC 1 cut(s) 14
FspBI CTAG 2 cut(s) 23, 242
GluI GCNGC 1 cut(s) 14
GsuI CTGGAG 1 cut(s) 60
HaeIII GGCC 1 cut(s) 80
Hin1II CATG 3 cut(s) 123, 203, 322
HinfI GANTC 1 cut(s) 373
HphI GGTGA 1 cut(s) 359
Hpy188I TCNGA 1 cut(s) 250
Hpy188III TCNNGA 2 cut(s) 39, 73
HpyAV CCTTC 1 cut(s) 70
HpyCH4V TGCA 2 cut(s) 123, 318
HpyF10VI GCNNNNNNNGC 1 cut(s) 201
HpyF3I CTNAG 2 cut(s) 159, 247
Hsp92II CATG 3 cut(s) 123, 203, 322
Kzo9I GATC 1 cut(s) 325
LpnPI CCDG 7 cut(s) 2, 24, 58, 67, 94, 156, 364
LweI GCATC 1 cut(s) 78
MaeI CTAG 2 cut(s) 23, 242
MaeIII GTNAC 2 cut(s) 164, 262
MalI GATC 1 cut(s) 327
MboI GATC 1 cut(s) 325
MboII GAAGA 1 cut(s) 403
MhlI GDGCHC 3 cut(s) 197, 334, 385
MluCI AATT 3 cut(s) 56, 287, 304
MnlI CCTC 4 cut(s) 108, 207, 249, 256
MseI TTAA 1 cut(s) 341
MspR9I CCNGG 1 cut(s) 82
MvaI CCWGG 1 cut(s) 82
MwoI GCNNNNNNNGC 1 cut(s) 201
NdeII GATC 1 cut(s) 325
NlaIII CATG 3 cut(s) 123, 203, 322
NspI RCATGY 2 cut(s) 123, 322
PaeI GCATGC 2 cut(s) 123, 322
PfeI GAWTC 1 cut(s) 373
PkrI GCNGC 1 cut(s) 15
Psp6I CCWGG 1 cut(s) 80
PspGI CCWGG 1 cut(s) 80
SaqAI TTAA 1 cut(s) 341
SatI GCNGC 1 cut(s) 14
Sau3AI GATC 1 cut(s) 325
ScrFI CCNGG 1 cut(s) 82
SduI GDGCHC 3 cut(s) 197, 334, 385
SetI ASST 3 cut(s) 9, 21, 28
SfaNI GCATC 1 cut(s) 78
SphI GCATGC 2 cut(s) 123, 322
Sse9I AATT 3 cut(s) 56, 287, 304
SsiI CCGC 2 cut(s) 14, 148
SspMI CTAG 2 cut(s) 23, 242
StyD4I CCNGG 1 cut(s) 80
TasI AATT 3 cut(s) 56, 287, 304
TauI GCSGC 1 cut(s) 16
TfiI GAWTC 1 cut(s) 373
Tru1I TTAA 1 cut(s) 341
Tru9I TTAA 1 cut(s) 341
TspDTI ATGAA 4 cut(s) 24, 170, 263, 300
TspGWI ACGGA 1 cut(s) 250
XapI RAATTY 1 cut(s) 304
XceI RCATGY 2 cut(s) 123, 322
XspI CTAG 2 cut(s) 23, 242
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.