Rmu_sc0006591.1_g000003

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006591.1
Physical Location & Seq
Forward (+)
13868 .. 15359
1492 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006591.1_g000003.1.cds

Sequence Viewer

Length: 1038 bp
atgttagctaagcagggatggagactggtgtccaaacccaactctttggtggctagaatatttaaagctcgatattttcccaattgctctttctgggaagcacaattaggcgacggaccatccttctcgtggagaagtattttggaaggtagaccggtgttgaaagcgggggtcaaatggagagtgggagatggtgaacaaattcatatttgggaggacaaatggattcctaattacttaaggtctcagattcacagaccggaaaactcaacttcattcgataggactgcgtactggattgccagagaacaagttcttcgtaatgctcttgcttctacttcacagggggatcattttaaggaactatggaagtgcctttggaaagctagagtgcctgccaaggtccaaatatgtgcatggagggcctgccaaaacatcctacccactagagagtgcaccaagggatatgatggtgaaacgaattgcctactgtgctctgctacccttgaggatacaacacacatcttctgtaagtgtccgattgcaaaagaaatcttctcagctcccccatttaatttacaatctatggctatgccaaatttggtttttaaggaatggatgctagaaactgctcttgtcattaagccagagacatttgaaaagttattaatgcttatatggtctctctggaaaaatcggaacactactctgtgggaggatagttccagaccgccttcgacggcaatacaactacagttgtcctctgtcagtatcgaaacagattggcttgctgctgttaaagaaattatgcaccaacaatctgattattcagagtttgcagccattattgctgacattcaggaactccagaaggggttaaatgaagcaccgattggttttgcacctaggaattgcaacaaagttgcgcacatactagctagtattggttttgaatctggtcaaaaggagtcgtggctccaaaatgctctcaattgtattctagatgtacttcaatatgattataaccatctgagctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

345

Amino Acids

39.58

Weight (kDa)

7.96

Isoelectric Point (pI)

58.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 1023
Acc16I TGCGCA 1 cut(s) 927
AccI GTMKAC 1 cut(s) 151
AciI CCGC 2 cut(s) 167, 731
AclWI GGATC 1 cut(s) 357
AcsI RAATTY 2 cut(s) 201, 598
AfaI GTAC 2 cut(s) 293, 1008
AfiI CCNNNNNNNGG 1 cut(s) 129
AflII CTTAAG 1 cut(s) 238
AgeI ACCGGT 1 cut(s) 154
AgsI TTSAA 4 cut(s) 163, 659, 953, 1013
AjuI GAANNNNNNNTTGG 4 cut(s) 74, 106, 876, 908
AluBI AGCT 6 cut(s) 8, 68, 386, 563, 938, 1035
AluI AGCT 6 cut(s) 8, 68, 386, 563, 938, 1035
Alw21I GWGCWC 2 cut(s) 458, 497
Alw26I GTCTC 4 cut(s) 16, 249, 644, 687
Alw44I GTGCAC 1 cut(s) 454
AlwI GGATC 1 cut(s) 357
AoxI GGCC 1 cut(s) 423
ApaLI GTGCAC 1 cut(s) 454
ApeKI GCWGC 2 cut(s) 791, 839
ApoI RAATTY 2 cut(s) 201, 598
AseI ATTAAT 1 cut(s) 668
AsiGI ACCGGT 1 cut(s) 154
Asp700I GAANNNNTTC 2 cut(s) 201, 312
AspA2I CCTAGG 1 cut(s) 905
AspLEI GCGC 1 cut(s) 928
AspS9I GGNCC 3 cut(s) 116, 403, 423
AsuHPI GGTGA 2 cut(s) 206, 485
AvaII GGWCC 2 cut(s) 116, 403
AvrII CCTAGG 1 cut(s) 905
BaeGI GKGCMC 1 cut(s) 458
BauI CACGAG 1 cut(s) 127
Bbv12I GWGCWC 2 cut(s) 458, 497
BbvI GCAGC 2 cut(s) 778, 851
BccI CCATC 5 cut(s) 12, 127, 185, 464, 1035
BceAI ACGGC 1 cut(s) 756
BcgI CGANNNNNNTGC 2 cut(s) 269, 303
BciVI GTATCC 1 cut(s) 505
BcoDI GTCTC 4 cut(s) 16, 249, 644, 687
BfaI CTAG 9 cut(s) 54, 387, 447, 623, 906, 935, 939, 1001, 1036
BfmI CTRYAG 1 cut(s) 752
BfrI CTTAAG 1 cut(s) 238
BfuI GTATCC 1 cut(s) 505
BisI GCNGC 2 cut(s) 792, 840
BlnI CCTAGG 1 cut(s) 905
BlpI GCTNAGC 1 cut(s) 9
BlsI GCNGC 2 cut(s) 793, 841
Bme18I GGWCC 2 cut(s) 116, 403
BmgT120I GGNCC 3 cut(s) 116, 403, 423
BmiI GGNNCC 1 cut(s) 977
BmsI GCATC 1 cut(s) 609
BoxI GACNNNNGTC 1 cut(s) 28
BpmI CTGGAG 1 cut(s) 851
Bpu1102I GCTNAGC 1 cut(s) 9
BpuEI CTTGAG 1 cut(s) 527
BsaI GGTCTC 2 cut(s) 249, 687
BsaJI CCNNGG 3 cut(s) 399, 459, 905
BsaWI WCCGGW 2 cut(s) 154, 259
Bsc4I CCNNNNNNNGG 1 cut(s) 129
Bse118I RCCGGY 1 cut(s) 154
Bse1I ACTGG 2 cut(s) 30, 299
BseDI CCNNGG 3 cut(s) 399, 459, 905
BseGI GGATG 4 cut(s) 23, 119, 435, 624
BseLI CCNNNNNNNGG 1 cut(s) 129
BseMII CTCAG 3 cut(s) 260, 573, 1022
BseNI ACTGG 2 cut(s) 30, 299
BseSI GKGCMC 1 cut(s) 458
BseXI GCAGC 2 cut(s) 778, 851
BshFI GGCC 1 cut(s) 425
BshTI ACCGGT 1 cut(s) 154
BsiHKAI GWGCWC 2 cut(s) 458, 497
BsiSI CCGG 2 cut(s) 155, 260
BslI CCNNNNNNNGG 1 cut(s) 129
BsmAI GTCTC 4 cut(s) 16, 249, 644, 687
BsnI GGCC 1 cut(s) 425
Bso31I GGTCTC 2 cut(s) 249, 687
Bsp1286I GDGCHC 2 cut(s) 458, 497
Bsp143I GATC 1 cut(s) 349
Bsp1720I GCTNAGC 1 cut(s) 9
BspACI CCGC 2 cut(s) 167, 731
BspANI GGCC 1 cut(s) 425
BspCNI CTCAG 3 cut(s) 259, 572, 1023
BspLI GGNNCC 1 cut(s) 977
BspPI GGATC 1 cut(s) 357
BspTI CTTAAG 1 cut(s) 238
BspTNI GGTCTC 2 cut(s) 249, 687
BsrFI RCCGGY 1 cut(s) 154
BsrI ACTGG 2 cut(s) 30, 299
BssAI RCCGGY 1 cut(s) 154
BssECI CCNNGG 3 cut(s) 399, 459, 905
BssMI GATC 1 cut(s) 349
BssSI CACGAG 1 cut(s) 127
BssT1I CCWWGG 3 cut(s) 399, 459, 905
Bst2BI CACGAG 1 cut(s) 127
Bst4CI ACNGT 2 cut(s) 492, 756
BstAFI CTTAAG 1 cut(s) 238
BstC8I GCNNGC 3 cut(s) 396, 427, 789
BstDEI CTNAG 4 cut(s) 9, 246, 559, 1031
BstF5I GGATG 4 cut(s) 23, 119, 435, 624
BstHHI GCGC 1 cut(s) 928
BstKTI GATC 1 cut(s) 352
BstMAI GTCTC 4 cut(s) 16, 249, 644, 687
BstMBI GATC 1 cut(s) 349
BstMWI GCNNNNNNNGC 3 cut(s) 422, 492, 848
BstPAI GACNNNNGTC 1 cut(s) 28
BstSFI CTRYAG 1 cut(s) 752
BstSLI GKGCMC 1 cut(s) 458
BstV1I GCAGC 2 cut(s) 778, 851
BstXI CCANNNNNNTGG 1 cut(s) 46
BsuI GTATCC 1 cut(s) 505
BsuRI GGCC 1 cut(s) 425
BtsCI GGATG 4 cut(s) 23, 119, 435, 624
Cac8I GCNNGC 3 cut(s) 396, 427, 789
CfoI GCGC 1 cut(s) 928
Cfr10I RCCGGY 1 cut(s) 154
Cfr13I GGNCC 3 cut(s) 116, 403, 423
Csp6I GTAC 2 cut(s) 292, 1007
CspAI ACCGGT 1 cut(s) 154
CviAII CATG 1 cut(s) 417
CviQI GTAC 2 cut(s) 292, 1007
DdeI CTNAG 4 cut(s) 9, 246, 559, 1031
DpnI GATC 1 cut(s) 351
DpnII GATC 1 cut(s) 349
DraI TTTAAA 1 cut(s) 64
Eco130I CCWWGG 3 cut(s) 399, 459, 905
Eco31I GGTCTC 2 cut(s) 249, 687
Eco47I GGWCC 2 cut(s) 116, 403
EcoO109I RGGNCCY 1 cut(s) 423
EcoT14I CCWWGG 3 cut(s) 399, 459, 905
ErhI CCWWGG 3 cut(s) 399, 459, 905
FaeI CATG 1 cut(s) 420
FatI CATG 1 cut(s) 416
FauI CCCGC 1 cut(s) 160
FblI GTMKAC 1 cut(s) 151
Fnu4HI GCNGC 2 cut(s) 792, 840
FokI GGATG 4 cut(s) 30, 106, 422, 631
Fsp4HI GCNGC 2 cut(s) 792, 840
FspBI CTAG 9 cut(s) 54, 387, 447, 623, 906, 935, 939, 1001, 1036
FspI TGCGCA 1 cut(s) 927
GlaI GCGC 1 cut(s) 927
GluI GCNGC 2 cut(s) 792, 840
GsuI CTGGAG 1 cut(s) 851
HaeIII GGCC 1 cut(s) 425
HapII CCGG 2 cut(s) 155, 260
HhaI GCGC 1 cut(s) 928
Hin1II CATG 1 cut(s) 420
Hin6I GCGC 1 cut(s) 926
HinP1I GCGC 1 cut(s) 926
HinfI GANTC 4 cut(s) 226, 250, 953, 968
HpaII CCGG 2 cut(s) 155, 260
HphI GGTGA 2 cut(s) 206, 485
Hpy166II GTNNAC 3 cut(s) 152, 197, 456
Hpy188I TCNGA 6 cut(s) 249, 540, 699, 823, 832, 1032
Hpy188III TCNNGA 5 cut(s) 688, 726, 860, 868, 1001
Hpy8I GTNNAC 3 cut(s) 152, 197, 456
Hpy99I CGWCG 2 cut(s) 116, 742
HpyAV CCTTC 4 cut(s) 133, 140, 744, 865
HpyCH4III ACNGT 2 cut(s) 492, 756
HpyCH4V TGCA 7 cut(s) 416, 456, 545, 811, 839, 902, 915
HpyF10VI GCNNNNNNNGC 3 cut(s) 422, 492, 848
HpyF3I CTNAG 4 cut(s) 9, 246, 559, 1031
Hsp92II CATG 1 cut(s) 420
HspAI GCGC 1 cut(s) 926
Kzo9I GATC 1 cut(s) 349
LmnI GCTCC 2 cut(s) 568, 981
Lsp1109I GCAGC 2 cut(s) 778, 851
LweI GCATC 1 cut(s) 609
MaeI CTAG 9 cut(s) 54, 387, 447, 623, 906, 935, 939, 1001, 1036
MalI GATC 1 cut(s) 351
MboI GATC 1 cut(s) 349
MboII GAAGA 3 cut(s) 308, 517, 547
MfeI CAATTG 2 cut(s) 82, 991
MhlI GDGCHC 2 cut(s) 458, 497
MlyI GAGTC 1 cut(s) 977
MnlI CCTC 5 cut(s) 208, 414, 502, 709, 772
MroXI GAANNNNTTC 2 cut(s) 201, 312
MseI TTAA 9 cut(s) 63, 239, 357, 573, 609, 642, 668, 798, 878
MspCI CTTAAG 1 cut(s) 238
MspI CCGG 2 cut(s) 155, 260
MunI CAATTG 2 cut(s) 82, 991
MwoI GCNNNNNNNGC 3 cut(s) 422, 492, 848
NdeII GATC 1 cut(s) 349
NlaIII CATG 1 cut(s) 420
NlaIV GGNNCC 1 cut(s) 977
NsbI TGCGCA 1 cut(s) 927
PdmI GAANNNNTTC 2 cut(s) 201, 312
PfeI GAWTC 3 cut(s) 226, 250, 953
PinAI ACCGGT 1 cut(s) 154
PkrI GCNGC 2 cut(s) 793, 841
PleI GAGTC 1 cut(s) 976
PpsI GAGTC 1 cut(s) 976
PshAI GACNNNNGTC 1 cut(s) 28
PshBI ATTAAT 1 cut(s) 668
PsiI TTATAA 1 cut(s) 1023
PspN4I GGNNCC 1 cut(s) 977
PspPI GGNCC 3 cut(s) 116, 403, 423
RsaI GTAC 2 cut(s) 293, 1008
RsaNI GTAC 2 cut(s) 292, 1007
SaqAI TTAA 9 cut(s) 63, 239, 357, 573, 609, 642, 668, 798, 878
SatI GCNGC 2 cut(s) 792, 840
Sau3AI GATC 1 cut(s) 349
Sau96I GGNCC 3 cut(s) 116, 403, 423
SchI GAGTC 1 cut(s) 977
SduI GDGCHC 2 cut(s) 458, 497
SfaNI GCATC 1 cut(s) 609
SfcI CTRYAG 1 cut(s) 752
SinI GGWCC 2 cut(s) 116, 403
SmlI CTYRAG 2 cut(s) 238, 506
SmoI CTYRAG 2 cut(s) 238, 506
SsiI CCGC 2 cut(s) 167, 731
SspI AATATT 1 cut(s) 60
SspMI CTAG 9 cut(s) 54, 387, 447, 623, 906, 935, 939, 1001, 1036
StyI CCWWGG 3 cut(s) 399, 459, 905
TaaI ACNGT 2 cut(s) 492, 756
TaqI TCGA 4 cut(s) 70, 279, 737, 774
TatI WGTACW 1 cut(s) 1006
TfiI GAWTC 3 cut(s) 226, 250, 953
Tru1I TTAA 9 cut(s) 63, 239, 357, 573, 609, 642, 668, 798, 878
Tru9I TTAA 9 cut(s) 63, 239, 357, 573, 609, 642, 668, 798, 878
TseI GCWGC 2 cut(s) 791, 839
TspDTI ATGAA 3 cut(s) 194, 264, 897
TspGWI ACGGA 1 cut(s) 129
Vha464I CTTAAG 1 cut(s) 238
VneI GTGCAC 1 cut(s) 454
VpaK11BI GGWCC 2 cut(s) 116, 403
VspI ATTAAT 1 cut(s) 668
XapI RAATTY 2 cut(s) 201, 598
XbaI TCTAGA 1 cut(s) 1000
XcmI CCANNNNNNNNNTGG 2 cut(s) 46, 126
XmaJI CCTAGG 1 cut(s) 905
XmiI GTMKAC 1 cut(s) 151
XmnI GAANNNNTTC 2 cut(s) 201, 312
XspI CTAG 9 cut(s) 54, 387, 447, 623, 906, 935, 939, 1001, 1036
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.