Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000432.1

Orthogroup ID

OG0002539

Physical Location & Seq

Genomic Coordinates Forward (+)

56087 .. 56533

Gene Structure 447 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000432.1_g000012.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 447 bp

atgtttgaatctatattatctgctcctccctttaacctgcagcatactcttcttccatcaattaattttaaagagtggatgttggaaagggcgatgcagttacatcctgagttgtttgctaaactgttaatgatcattcatgggatctggaggaacatgaataatacattatggcagaacaaaactcaaattgctcaagacttggttttgagcagcttcacatggctggaggagtttactagggtccatgttgtcagtaacaaatcgaacaaaatacaacagaaaatgtggaaacctgctgcacaaggaagcctcacattaaatgtggatgctgctttccttcctgatcaacatcaagggggcattggtggagtgcttagggactaccagggacgcttcagagcagcttttgcatgtcccatcccctatactgcatctccaaaatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RVT_3 zf-RVT

Protein Analysis

148

Amino Acids

16.96

Weight (kDa)

9.46

Isoelectric Point (pI)

41.88

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002539)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g19763
pyrus_communis	pycom11g21530
rosa_chinensis	RchiOBHm_Chr3g0477221 RchiOBHm_Chr5g0044911
rosa_laevigata	RLG00000002565
rosa_multiflora	Rmu_co8232993.1_g000001 Rmu_sc0000841.1_g000006 Rmu_sc0000957.1_g000002 Rmu_sc0001035.1_g000054 Rmu_sc0001616.1_g000042 Rmu_sc0001616.1_g000043 Rmu_sc0001911.1_g000006 Rmu_sc0002195.1_g000001 Rmu_sc0002407.1_g000016 Rmu_sc0002854.1_g000009 Rmu_sc0003722.1_g000038 Rmu_sc0004084.1_g000060 Rmu_sc0005693.1_g000013 Rmu_sc0006255.1_g000005 Rmu_sc0006591.1_g000003 Rmu_sc0007409.1_g000001 Rmu_sc0007793.1_g000004 Rmu_sc0009420.1_g000001 Rmu_sc0010368.1_g000005 Rmu_sc0010867.1_g000001 Rmu_ssc0000432.1_g000012
rosa_roxburghii	Rroxscaffold_3G00243150
rosa_rugosa	Rorug01G0183800 Rorug03G0046000 Rorug03G0189600 Rorug03G0283000 Rorug03G0330400 Rorug04G0001200 Rorug04G0105000 Rorug04G0142500 Rorug05G0219200 Rorug05G0240300 Rorug05G0266300 Rorug05G0507900 Rorug07G0104400 Rorug07G0113800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	2 cut(s)	45, 304
AclWI	GGATC	1 cut(s)	152
AcuI	CTGAAG	1 cut(s)	382
AgsI	TTSAA	1 cut(s)	8
AjnI	CCWGG	1 cut(s)	387
AluBI	AGCT	2 cut(s)	216, 407
AluI	AGCT	2 cut(s)	216, 407
AlwI	GGATC	1 cut(s)	152
ApeKI	GCWGC	5 cut(s)	40, 213, 299, 332, 404
AseI	ATTAAT	1 cut(s)	63
AspS9I	GGNCC	1 cut(s)	244
AvaII	GGWCC	1 cut(s)	244
BbvI	GCAGC	5 cut(s)	52, 225, 286, 319, 416
BccI	CCATC	2 cut(s)	64, 428
BciT130I	CCWGG	1 cut(s)	389
BclI	TGATCA	2 cut(s)	132, 346
BfaI	CTAG	1 cut(s)	240
BfmI	CTRYAG	1 cut(s)	38
BfuAI	ACCTGC	2 cut(s)	45, 304
BisI	GCNGC	5 cut(s)	41, 214, 300, 333, 405
BlsI	GCNGC	5 cut(s)	42, 215, 301, 334, 406
Bme1390I	CCNGG	1 cut(s)	389
Bme18I	GGWCC	1 cut(s)	244
BmgT120I	GGNCC	1 cut(s)	244
BmiI	GGNNCC	1 cut(s)	245
BmrFI	CCNGG	1 cut(s)	389
BmsI	GCATC	3 cut(s)	84, 319, 443
BpmI	CTGGAG	2 cut(s)	169, 248
Bpu10I	CCTNAGC	1 cut(s)	377
BpuEI	CTTGAG	1 cut(s)	180
BsaBI	GATNNNNATC	1 cut(s)	351
BsaJI	CCNNGG	1 cut(s)	388
BsaXI	ACNNNNNCTCC	1 cut(s)	421
Bse8I	GATNNNNATC	1 cut(s)	351
BseBI	CCWGG	1 cut(s)	389
BseDI	CCNNGG	1 cut(s)	388
BseGI	GGATG	4 cut(s)	84, 103, 334, 420
BseJI	GATNNNNATC	1 cut(s)	351
BseMII	CTCAG	1 cut(s)	99
BseRI	GAGGAG	2 cut(s)	15, 245
BseXI	GCAGC	5 cut(s)	52, 225, 286, 319, 416
BsgI	GTGCAG	1 cut(s)	285
BslFI	GGGAC	3 cut(s)	395, 402, 405
BsmFI	GGGAC	3 cut(s)	395, 402, 405
Bsp143I	GATC	3 cut(s)	132, 144, 346
BspCNI	CTCAG	1 cut(s)	100
BspLI	GGNNCC	1 cut(s)	245
BspMAI	CTGCAG	1 cut(s)	42
BspMI	ACCTGC	2 cut(s)	45, 304
BspPI	GGATC	1 cut(s)	152
BssECI	CCNNGG	1 cut(s)	388
BssMI	GATC	3 cut(s)	132, 144, 346
Bst2UI	CCWGG	1 cut(s)	389
Bst4CI	ACNGT	1 cut(s)	126
Bst6I	CTCTTC	1 cut(s)	54
BstAPI	GCANNNNNTGC	1 cut(s)	410
BstDEI	CTNAG	2 cut(s)	108, 377
BstF5I	GGATG	4 cut(s)	84, 103, 334, 420
BstKTI	GATC	3 cut(s)	135, 147, 349
BstMBI	GATC	3 cut(s)	132, 144, 346
BstMWI	GCNNNNNNNGC	1 cut(s)	410
BstNI	CCWGG	1 cut(s)	389
BstNSI	RCATGY	1 cut(s)	417
BstSCI	CCNGG	1 cut(s)	387
BstSFI	CTRYAG	1 cut(s)	38
BstV1I	GCAGC	5 cut(s)	52, 225, 286, 319, 416
BstX2I	RGATCY	1 cut(s)	144
BstYI	RGATCY	1 cut(s)	144
BtgZI	GCGATG	1 cut(s)	107
BtsCI	GGATG	4 cut(s)	84, 103, 334, 420
BveI	ACCTGC	2 cut(s)	45, 304
Cfr13I	GGNCC	1 cut(s)	244
CseI	GACGC	1 cut(s)	402
CviAII	CATG	5 cut(s)	140, 157, 222, 248, 414
CviJI	RGCY	4 cut(s)	216, 226, 312, 407
CviKI_1	RGCY	4 cut(s)	216, 226, 312, 407
DdeI	CTNAG	2 cut(s)	108, 377
DpnI	GATC	3 cut(s)	134, 146, 348
DpnII	GATC	3 cut(s)	132, 144, 346
DraI	TTTAAA	1 cut(s)	70
Eam1104I	CTCTTC	1 cut(s)	54
EarI	CTCTTC	1 cut(s)	54
Eco47I	GGWCC	1 cut(s)	244
Eco57I	CTGAAG	1 cut(s)	382
EcoRII	CCWGG	1 cut(s)	387
FaeI	CATG	5 cut(s)	143, 160, 225, 251, 417
FaiI	YATR	9 cut(s)	14, 45, 141, 158, 172, 223, 249, 415, 429
FaqI	GGGAC	3 cut(s)	395, 402, 405
FatI	CATG	5 cut(s)	139, 156, 221, 247, 413
FbaI	TGATCA	2 cut(s)	132, 346
Fnu4HI	GCNGC	5 cut(s)	41, 214, 300, 333, 405
FokI	GGATG	4 cut(s)	90, 91, 341, 407
Fsp4HI	GCNGC	5 cut(s)	41, 214, 300, 333, 405
FspBI	CTAG	1 cut(s)	240
GluI	GCNGC	5 cut(s)	41, 214, 300, 333, 405
GsuI	CTGGAG	2 cut(s)	169, 248
HgaI	GACGC	1 cut(s)	402
Hin1II	CATG	5 cut(s)	143, 160, 225, 251, 417
HinfI	GANTC	1 cut(s)	8
Hpy166II	GTNNAC	1 cut(s)	237
Hpy188I	TCNGA	1 cut(s)	401
Hpy188III	TCNNGA	4 cut(s)	107, 148, 197, 344
Hpy8I	GTNNAC	1 cut(s)	237
HpyAV	CCTTC	1 cut(s)	350
HpyCH4III	ACNGT	1 cut(s)	126
HpyCH4V	TGCA	5 cut(s)	40, 97, 302, 413, 434
HpyF10VI	GCNNNNNNNGC	1 cut(s)	410
HpyF3I	CTNAG	2 cut(s)	108, 377
Hsp92II	CATG	5 cut(s)	143, 160, 225, 251, 417
Ksp22I	TGATCA	2 cut(s)	132, 346
Kzo9I	GATC	3 cut(s)	132, 144, 346
LmnI	GCTCC	1 cut(s)	28
LpnPI	CCDG	8 cut(s)	50, 120, 133, 212, 309, 357, 374, 401
Lsp1109I	GCAGC	5 cut(s)	52, 225, 286, 319, 416
LweI	GCATC	3 cut(s)	84, 319, 443
MaeI	CTAG	1 cut(s)	240
MaeIII	GTNAC	2 cut(s)	99, 257
MalI	GATC	3 cut(s)	134, 146, 348
MboI	GATC	3 cut(s)	132, 144, 346
MboII	GAAGA	2 cut(s)	41, 44
MflI	RGATCY	1 cut(s)	144
MluCI	AATT	3 cut(s)	60, 64, 189
MmeI	TCCRAC	1 cut(s)	63
MnlI	CCTC	4 cut(s)	36, 144, 223, 323
MseI	TTAA	5 cut(s)	33, 63, 69, 128, 320
MspR9I	CCNGG	1 cut(s)	389
MvaI	CCWGG	1 cut(s)	389
MwoI	GCNNNNNNNGC	1 cut(s)	410
NdeII	GATC	3 cut(s)	132, 144, 346
NlaIII	CATG	5 cut(s)	143, 160, 225, 251, 417
NlaIV	GGNNCC	1 cut(s)	245
NspI	RCATGY	1 cut(s)	417
PfeI	GAWTC	1 cut(s)	8
PkrI	GCNGC	5 cut(s)	42, 215, 301, 334, 406
PshBI	ATTAAT	1 cut(s)	63
Psp6I	CCWGG	1 cut(s)	387
PspGI	CCWGG	1 cut(s)	387
PspN4I	GGNNCC	1 cut(s)	245
PspPI	GGNCC	1 cut(s)	244
PstI	CTGCAG	1 cut(s)	42
PsuI	RGATCY	1 cut(s)	144
SaqAI	TTAA	5 cut(s)	33, 63, 69, 128, 320
SatI	GCNGC	5 cut(s)	41, 214, 300, 333, 405
Sau3AI	GATC	3 cut(s)	132, 144, 346
Sau96I	GGNCC	1 cut(s)	244
ScrFI	CCNGG	1 cut(s)	389
SetI	ASST	4 cut(s)	39, 218, 298, 409
SfaNI	GCATC	3 cut(s)	84, 319, 443
SfcI	CTRYAG	1 cut(s)	38
SinI	GGWCC	1 cut(s)	244
SmlI	CTYRAG	1 cut(s)	195
SmoI	CTYRAG	1 cut(s)	195
Sse9I	AATT	3 cut(s)	60, 64, 189
SspMI	CTAG	1 cut(s)	240
StyD4I	CCNGG	1 cut(s)	387
TaaI	ACNGT	1 cut(s)	126
TaqI	TCGA	1 cut(s)	266
TasI	AATT	3 cut(s)	60, 64, 189
TfiI	GAWTC	1 cut(s)	8
Tru1I	TTAA	5 cut(s)	33, 63, 69, 128, 320
Tru9I	TTAA	5 cut(s)	33, 63, 69, 128, 320
TseI	GCWGC	5 cut(s)	40, 213, 299, 332, 404
TspDTI	ATGAA	2 cut(s)	128, 173
VpaK11BI	GGWCC	1 cut(s)	244
VspI	ATTAAT	1 cut(s)	63
XceI	RCATGY	1 cut(s)	417
XspI	CTAG	1 cut(s)	240

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.