Rroxscaffold_3G00243150

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
35700508 .. 35713879
13372 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00243150.1

Sequence Viewer

Length: 249 bp
ATGCAATCACGACTTAAAAACAATGCTCATTGGTTTTGTAAGTGCCCTACCGCTTTTGAGTTTCTCTATGCTACTCCTTTTACTCTTCATCATTTAACACCGCCAAACTTGAATATCAAAGAATGGATGTTGGAACAAGCACTTCATCTTAAGGCAGAACTGTTTGAAAAGTTTGTTATGATTATTTGGGGACCGTGGAAGAATCGTAACACCAAACTGTGGGAAGGTCCAAGTAAAATCCTCAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

82

Amino Acids

9.85

Weight (kDa)

9.51

Isoelectric Point (pI)

34.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 219
AciI CCGC 2 cut(s) 51, 101
AfiI CCNNNNNNNGG 1 cut(s) 219
AflII CTTAAG 1 cut(s) 149
AgsI TTSAA 2 cut(s) 112, 167
AspS9I GGNCC 2 cut(s) 191, 227
AvaII GGWCC 2 cut(s) 191, 227
BaeGI GKGCMC 1 cut(s) 47
BfrI CTTAAG 1 cut(s) 149
Bme18I GGWCC 2 cut(s) 191, 227
BmgT120I GGNCC 2 cut(s) 191, 227
BmiI GGNNCC 1 cut(s) 192
BsaJI CCNNGG 1 cut(s) 194
Bsc4I CCNNNNNNNGG 1 cut(s) 219
BseDI CCNNGG 1 cut(s) 194
BseGI GGATG 1 cut(s) 132
BseLI CCNNNNNNNGG 1 cut(s) 219
BseSI GKGCMC 1 cut(s) 47
BslFI GGGAC 1 cut(s) 204
BslI CCNNNNNNNGG 1 cut(s) 219
BsmFI GGGAC 1 cut(s) 204
Bsp1286I GDGCHC 1 cut(s) 47
BspACI CCGC 2 cut(s) 51, 101
BspLI GGNNCC 1 cut(s) 192
BspTI CTTAAG 1 cut(s) 149
BssECI CCNNGG 1 cut(s) 194
Bst4CI ACNGT 3 cut(s) 162, 195, 219
Bst6I CTCTTC 1 cut(s) 90
BstAFI CTTAAG 1 cut(s) 149
BstDSI CCRYGG 1 cut(s) 194
BstF5I GGATG 1 cut(s) 132
BstSLI GKGCMC 1 cut(s) 47
BtgI CCRYGG 1 cut(s) 194
BtsCI GGATG 1 cut(s) 132
Cfr13I GGNCC 2 cut(s) 191, 227
Eam1104I CTCTTC 1 cut(s) 90
EarI CTCTTC 1 cut(s) 90
Eco47I GGWCC 2 cut(s) 191, 227
FaiI YATR 2 cut(s) 69, 179
FaqI GGGAC 1 cut(s) 204
FokI GGATG 1 cut(s) 139
HinfI GANTC 1 cut(s) 202
Hpy188III TCNNGA 1 cut(s) 9
HpyAV CCTTC 1 cut(s) 218
HpyCH4III ACNGT 3 cut(s) 162, 195, 219
HpyCH4V TGCA 1 cut(s) 4
MaeIII GTNAC 1 cut(s) 206
MboII GAAGA 2 cut(s) 77, 211
MhlI GDGCHC 1 cut(s) 47
MmeI TCCRAC 1 cut(s) 111
MseI TTAA 3 cut(s) 15, 95, 150
MspCI CTTAAG 1 cut(s) 149
NlaIV GGNNCC 1 cut(s) 192
PfeI GAWTC 1 cut(s) 202
PflMI CCANNNNNTGG 1 cut(s) 219
PspN4I GGNNCC 1 cut(s) 192
PspPI GGNCC 2 cut(s) 191, 227
SaqAI TTAA 3 cut(s) 15, 95, 150
Sau96I GGNCC 2 cut(s) 191, 227
SduI GDGCHC 1 cut(s) 47
SetI ASST 1 cut(s) 229
SgeI CNNG 5 cut(s) 21, 121, 149, 207, 243
SinI GGWCC 2 cut(s) 191, 227
SmlI CTYRAG 1 cut(s) 149
SmoI CTYRAG 1 cut(s) 149
SsiI CCGC 2 cut(s) 51, 101
TaaI ACNGT 3 cut(s) 162, 195, 219
TfiI GAWTC 1 cut(s) 202
Tru1I TTAA 3 cut(s) 15, 95, 150
Tru9I TTAA 3 cut(s) 15, 95, 150
TspDTI ATGAA 2 cut(s) 77, 134
Van91I CCANNNNNTGG 1 cut(s) 219
Vha464I CTTAAG 1 cut(s) 149
VpaK11BI GGWCC 2 cut(s) 191, 227
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.