Rorug03G0330400

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
OG0002539
Physical Location & Seq
Reverse (-)
38353308 .. 38353694
387 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0330400.1

Sequence Viewer

Length: 387 bp
ATGAATTATGATGATGTGATCAATCATACCAATAATGTTGAGAATGAAGTGGCTGACGTAAGTATGCAGCAAAGTGTCCCTCAAAATGATGTGATTAAAGAGGACATGGGCCCATGGATGTTGATGAGCTACAGAAATAAAAAGAAAAATGGTGATACTAGCAGTAATAAGAAATCTTCTGCTGCTGGCTCTAGATTTGCTGTGCTTCAAGATGAGACTGTGGCTGATTCTGAATTGCCTGGAAAGACTATTGATGACAATAATAATGAACAGTCCCCTACTATTGTGAAATTGTGGCAGAGTTTCCAAGAGAAAAAAAAGAAGATCCCAAGCCCTACCAAAGATAAGCATGCTGATACCCCTGTTGGTGTCTCCTCTAGCAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 zf-RVT

Protein Analysis

128

Amino Acids

14.24

Weight (kDa)

5.66

Isoelectric Point (pI)

54.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 319
AgsI TTSAA 1 cut(s) 209
AjnI CCWGG 1 cut(s) 238
AluBI AGCT 1 cut(s) 129
AluI AGCT 1 cut(s) 129
Alw26I GTCTC 2 cut(s) 209, 376
AlwI GGATC 1 cut(s) 319
AoxI GGCC 1 cut(s) 109
ApaI GGGCCC 1 cut(s) 113
ApeKI GCWGC 2 cut(s) 67, 182
AspS9I GGNCC 2 cut(s) 109, 110
AsuHPI GGTGA 1 cut(s) 164
BaeGI GKGCMC 1 cut(s) 113
BaeI ACNNNNGTAYC 2 cut(s) 348, 381
BanII GRGCYC 1 cut(s) 113
BbvI GCAGC 2 cut(s) 79, 169
BciT130I CCWGG 1 cut(s) 240
BclI TGATCA 1 cut(s) 18
BcoDI GTCTC 2 cut(s) 209, 376
BfaI CTAG 3 cut(s) 159, 192, 378
BfmI CTRYAG 1 cut(s) 130
BisI GCNGC 2 cut(s) 68, 183
BlsI GCNGC 2 cut(s) 69, 184
Bme1390I CCNGG 1 cut(s) 240
BmgT120I GGNCC 2 cut(s) 109, 110
BmiI GGNNCC 1 cut(s) 111
BmrFI CCNGG 1 cut(s) 240
BsaJI CCNNGG 1 cut(s) 113
BseBI CCWGG 1 cut(s) 240
BseDI CCNNGG 1 cut(s) 113
BseGI GGATG 1 cut(s) 123
BseRI GAGGAG 1 cut(s) 364
BseSI GKGCMC 1 cut(s) 113
BseXI GCAGC 2 cut(s) 79, 169
BshFI GGCC 1 cut(s) 111
BslFI GGGAC 2 cut(s) 62, 259
BsmAI GTCTC 2 cut(s) 209, 376
BsmFI GGGAC 2 cut(s) 62, 259
BsnI GGCC 1 cut(s) 111
Bsp120I GGGCCC 1 cut(s) 109
Bsp1286I GDGCHC 1 cut(s) 113
Bsp143I GATC 2 cut(s) 18, 324
Bsp19I CCATGG 1 cut(s) 113
BspANI GGCC 1 cut(s) 111
BspLI GGNNCC 1 cut(s) 111
BspPI GGATC 1 cut(s) 319
BssECI CCNNGG 1 cut(s) 113
BssMI GATC 2 cut(s) 18, 324
BssT1I CCWWGG 1 cut(s) 113
Bst2UI CCWGG 1 cut(s) 240
Bst4CI ACNGT 2 cut(s) 220, 273
BstC8I GCNNGC 2 cut(s) 187, 351
BstDSI CCRYGG 1 cut(s) 113
BstF5I GGATG 1 cut(s) 123
BstKTI GATC 2 cut(s) 21, 327
BstMAI GTCTC 2 cut(s) 209, 376
BstMBI GATC 2 cut(s) 18, 324
BstNI CCWGG 1 cut(s) 240
BstNSI RCATGY 1 cut(s) 353
BstSCI CCNGG 1 cut(s) 238
BstSFI CTRYAG 1 cut(s) 130
BstSLI GKGCMC 1 cut(s) 113
BstV1I GCAGC 2 cut(s) 79, 169
BstX2I RGATCY 1 cut(s) 324
BstYI RGATCY 1 cut(s) 324
BsuRI GGCC 1 cut(s) 111
BtgI CCRYGG 1 cut(s) 113
BtsCI GGATG 1 cut(s) 123
Cac8I GCNNGC 2 cut(s) 187, 351
Cfr13I GGNCC 2 cut(s) 109, 110
CviAII CATG 3 cut(s) 106, 114, 350
CviJI RGCY 6 cut(s) 53, 111, 129, 189, 224, 333
CviKI_1 RGCY 6 cut(s) 53, 111, 129, 189, 224, 333
DpnI GATC 2 cut(s) 20, 326
DpnII GATC 2 cut(s) 18, 324
Eco130I CCWWGG 1 cut(s) 113
Eco24I GRGCYC 1 cut(s) 113
EcoRII CCWGG 1 cut(s) 238
EcoT14I CCWWGG 1 cut(s) 113
EcoT38I GRGCYC 1 cut(s) 113
ErhI CCWWGG 1 cut(s) 113
FaeI CATG 3 cut(s) 109, 117, 353
FaiI YATR 6 cut(s) 9, 27, 65, 107, 115, 351
FaqI GGGAC 2 cut(s) 62, 259
FatI CATG 3 cut(s) 105, 113, 349
FbaI TGATCA 1 cut(s) 18
Fnu4HI GCNGC 2 cut(s) 68, 183
FokI GGATG 1 cut(s) 130
FriOI GRGCYC 1 cut(s) 113
Fsp4HI GCNGC 2 cut(s) 68, 183
FspBI CTAG 3 cut(s) 159, 192, 378
GluI GCNGC 2 cut(s) 68, 183
HaeIII GGCC 1 cut(s) 111
Hin1II CATG 3 cut(s) 109, 117, 353
HinfI GANTC 1 cut(s) 227
HphI GGTGA 1 cut(s) 164
Hpy188I TCNGA 1 cut(s) 232
Hpy188III TCNNGA 2 cut(s) 192, 209
HpyCH4III ACNGT 2 cut(s) 220, 273
HpyCH4IV ACGT 1 cut(s) 57
HpyCH4V TGCA 1 cut(s) 67
HpySE526I ACGT 1 cut(s) 57
Hsp92II CATG 3 cut(s) 109, 117, 353
Ksp22I TGATCA 1 cut(s) 18
Kzo9I GATC 2 cut(s) 18, 324
LpnPI CCDG 4 cut(s) 171, 225, 252, 375
Lsp1109I GCAGC 2 cut(s) 79, 169
MaeI CTAG 3 cut(s) 159, 192, 378
MaeII ACGT 1 cut(s) 57
MalI GATC 2 cut(s) 20, 326
MboI GATC 2 cut(s) 18, 324
MboII GAAGA 2 cut(s) 168, 334
MflI RGATCY 1 cut(s) 324
MhlI GDGCHC 1 cut(s) 113
MluCI AATT 3 cut(s) 4, 233, 290
MnlI CCTC 3 cut(s) 90, 94, 385
MseI TTAA 1 cut(s) 96
MspR9I CCNGG 1 cut(s) 240
MvaI CCWGG 1 cut(s) 240
NcoI CCATGG 1 cut(s) 113
NdeII GATC 2 cut(s) 18, 324
NlaIII CATG 3 cut(s) 109, 117, 353
NlaIV GGNNCC 1 cut(s) 111
NspI RCATGY 1 cut(s) 353
PaeI GCATGC 1 cut(s) 353
PfeI GAWTC 1 cut(s) 227
PkrI GCNGC 2 cut(s) 69, 184
Psp6I CCWGG 1 cut(s) 238
PspGI CCWGG 1 cut(s) 238
PspN4I GGNNCC 1 cut(s) 111
PspOMI GGGCCC 1 cut(s) 109
PspPI GGNCC 2 cut(s) 109, 110
PsuI RGATCY 1 cut(s) 324
SaqAI TTAA 1 cut(s) 96
SatI GCNGC 2 cut(s) 68, 183
Sau3AI GATC 2 cut(s) 18, 324
Sau96I GGNCC 2 cut(s) 109, 110
ScrFI CCNGG 1 cut(s) 240
SduI GDGCHC 1 cut(s) 113
SetI ASST 2 cut(s) 60, 131
SfcI CTRYAG 1 cut(s) 130
SphI GCATGC 1 cut(s) 353
Sse9I AATT 3 cut(s) 4, 233, 290
SspMI CTAG 3 cut(s) 159, 192, 378
StyD4I CCNGG 1 cut(s) 238
StyI CCWWGG 1 cut(s) 113
TaaI ACNGT 2 cut(s) 220, 273
TaiI ACGT 1 cut(s) 60
TasI AATT 3 cut(s) 4, 233, 290
TfiI GAWTC 1 cut(s) 227
Tru1I TTAA 1 cut(s) 96
Tru9I TTAA 1 cut(s) 96
TseI GCWGC 2 cut(s) 67, 182
TspDTI ATGAA 3 cut(s) 17, 60, 282
XbaI TCTAGA 1 cut(s) 191
XceI RCATGY 1 cut(s) 353
XspI CTAG 3 cut(s) 159, 192, 378
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.