Rmu_sc0001911.1_g000006

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001911.1
Physical Location & Seq
Forward (+)
23619 .. 24035
417 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001911.1_g000006.1.cds

Sequence Viewer

Length: 417 bp
atggaggtaatgcaacatgttctagtgtctacttcatctggggacctttacaaggaactttggaaaagtatctggaaggccaaagtgcccggcaaggtcagcatatgtgtgtggagagcatgcaataatttgcttgctacaagagacaggttattgctcaagggatacactggggagttacactgtcttctttgtcagcataatattgaagacgcatctcacttattatgtaaatgccccatcgcctcaactattctctctgagcctccttttaacctacaatcggaactatctttggttgcaagtttcaaagattggatgctggatagagccctttttacactcagtggggaggtatttgctaaacttatgatgatcttgtgggccatttggaaggacaggaacaactttctatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

138

Amino Acids

15.8

Weight (kDa)

8.23

Isoelectric Point (pI)

36.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 29
AdeI CACNNNGTG 1 cut(s) 347
AfiI CCNNNNNNNGG 2 cut(s) 52, 283
AflIII ACRYGT 1 cut(s) 16
AgsI TTSAA 2 cut(s) 209, 310
Alw26I GTCTC 1 cut(s) 138
AoxI GGCC 2 cut(s) 78, 384
AspS9I GGNCC 2 cut(s) 43, 384
AsuC2I CCSGG 1 cut(s) 90
AvaII GGWCC 1 cut(s) 43
BaeGI GKGCMC 1 cut(s) 90
BanII GRGCYC 1 cut(s) 334
BbsI GAAGAC 2 cut(s) 179, 216
BccI CCATC 1 cut(s) 248
BciVI GTATCC 1 cut(s) 158
BcnI CCSGG 1 cut(s) 90
BcoDI GTCTC 1 cut(s) 138
BfaI CTAG 1 cut(s) 23
BfmI CTRYAG 1 cut(s) 413
BfuI GTATCC 1 cut(s) 158
Bme1390I CCNGG 1 cut(s) 90
Bme18I GGWCC 1 cut(s) 43
BmgT120I GGNCC 2 cut(s) 43, 384
BmiI GGNNCC 1 cut(s) 44
BmrFI CCNGG 1 cut(s) 90
BmrI ACTGGG 1 cut(s) 180
BmsI GCATC 2 cut(s) 224, 309
BmuI ACTGGG 1 cut(s) 180
BpiI GAAGAC 2 cut(s) 179, 216
BpuEI CTTGAG 1 cut(s) 143
BpuMI CCSGG 1 cut(s) 90
Bsc4I CCNNNNNNNGG 2 cut(s) 52, 283
Bse1I ACTGG 1 cut(s) 175
BseGI GGATG 1 cut(s) 324
BseLI CCNNNNNNNGG 2 cut(s) 52, 283
BseMII CTCAG 2 cut(s) 252, 358
BseNI ACTGG 1 cut(s) 175
BseSI GKGCMC 1 cut(s) 90
BshFI GGCC 2 cut(s) 80, 386
BsiSI CCGG 1 cut(s) 90
BslFI GGGAC 1 cut(s) 56
BslI CCNNNNNNNGG 2 cut(s) 52, 283
BsmAI GTCTC 1 cut(s) 138
BsmFI GGGAC 1 cut(s) 56
BsnI GGCC 2 cut(s) 80, 386
Bsp1286I GDGCHC 2 cut(s) 90, 334
Bsp143I GATC 1 cut(s) 375
BspANI GGCC 2 cut(s) 80, 386
BspCNI CTCAG 2 cut(s) 253, 357
BspLI GGNNCC 1 cut(s) 44
BsrI ACTGG 1 cut(s) 175
BssMI GATC 1 cut(s) 375
Bst4CI ACNGT 1 cut(s) 185
BstC8I GCNNGC 2 cut(s) 121, 135
BstDEI CTNAG 2 cut(s) 261, 344
BstENI CCTNNNNNAGG 1 cut(s) 50
BstF5I GGATG 1 cut(s) 324
BstKTI GATC 1 cut(s) 378
BstMAI GTCTC 1 cut(s) 138
BstMBI GATC 1 cut(s) 375
BstMWI GCNNNNNNNGC 1 cut(s) 99
BstNSI RCATGY 2 cut(s) 20, 123
BstSCI CCNGG 1 cut(s) 88
BstSFI CTRYAG 1 cut(s) 413
BstSLI GKGCMC 1 cut(s) 90
BstV2I GAAGAC 2 cut(s) 179, 216
BsuI GTATCC 1 cut(s) 158
BsuRI GGCC 2 cut(s) 80, 386
BtgZI GCGATG 1 cut(s) 226
BtsCI GGATG 1 cut(s) 324
BtsIMutI CAGTG 3 cut(s) 168, 181, 352
Cac8I GCNNGC 2 cut(s) 121, 135
Cfr13I GGNCC 2 cut(s) 43, 384
CseI GACGC 1 cut(s) 221
CviAII CATG 2 cut(s) 17, 120
CviJI RGCY 4 cut(s) 80, 265, 332, 386
CviKI_1 RGCY 4 cut(s) 80, 265, 332, 386
DdeI CTNAG 2 cut(s) 261, 344
DpnI GATC 1 cut(s) 377
DpnII GATC 1 cut(s) 375
DraIII CACNNNGTG 1 cut(s) 347
Eco24I GRGCYC 1 cut(s) 334
Eco47I GGWCC 1 cut(s) 43
EcoNI CCTNNNNNAGG 1 cut(s) 50
EcoO109I RGGNCCY 1 cut(s) 43
EcoT38I GRGCYC 1 cut(s) 334
FaeI CATG 2 cut(s) 20, 123
FaiI YATR 8 cut(s) 18, 104, 106, 121, 201, 229, 371, 415
FaqI GGGAC 1 cut(s) 56
FatI CATG 2 cut(s) 16, 119
FauNDI CATATG 1 cut(s) 104
FblI GTMKAC 1 cut(s) 29
FokI GGATG 1 cut(s) 331
FriOI GRGCYC 1 cut(s) 334
FspBI CTAG 1 cut(s) 23
HaeIII GGCC 2 cut(s) 80, 386
HapII CCGG 1 cut(s) 90
HgaI GACGC 1 cut(s) 221
Hin1II CATG 2 cut(s) 20, 123
HpaII CCGG 1 cut(s) 90
Hpy166II GTNNAC 1 cut(s) 30
Hpy188I TCNGA 2 cut(s) 262, 286
Hpy188III TCNNGA 1 cut(s) 73
Hpy8I GTNNAC 1 cut(s) 30
HpyAV CCTTC 2 cut(s) 70, 388
HpyCH4III ACNGT 1 cut(s) 185
HpyCH4V TGCA 3 cut(s) 13, 123, 302
HpyF10VI GCNNNNNNNGC 1 cut(s) 99
HpyF3I CTNAG 2 cut(s) 261, 344
Hsp92II CATG 2 cut(s) 20, 123
Kzo9I GATC 1 cut(s) 375
LpnPI CCDG 7 cut(s) 24, 58, 103, 133, 156, 308, 385
LweI GCATC 2 cut(s) 224, 309
MaeI CTAG 1 cut(s) 23
MaeIII GTNAC 1 cut(s) 177
MalI GATC 1 cut(s) 377
MboI GATC 1 cut(s) 375
MboII GAAGA 2 cut(s) 179, 221
MhlI GDGCHC 2 cut(s) 90, 334
MluCI AATT 1 cut(s) 127
MnlI CCTC 3 cut(s) 256, 276, 346
MseI TTAA 1 cut(s) 273
MslI CAYNNNNRTG 1 cut(s) 107
MspI CCGG 1 cut(s) 90
MspR9I CCNGG 1 cut(s) 90
MwoI GCNNNNNNNGC 1 cut(s) 99
NciI CCSGG 1 cut(s) 90
NdeI CATATG 1 cut(s) 104
NdeII GATC 1 cut(s) 375
NlaIII CATG 2 cut(s) 20, 123
NlaIV GGNNCC 1 cut(s) 44
NspI RCATGY 2 cut(s) 20, 123
PaeI GCATGC 1 cut(s) 123
PciI ACATGT 1 cut(s) 16
PpuMI RGGWCCY 1 cut(s) 43
PscI ACATGT 1 cut(s) 16
Psp5II RGGWCCY 1 cut(s) 43
PspN4I GGNNCC 1 cut(s) 44
PspPI GGNCC 2 cut(s) 43, 384
PspPPI RGGWCCY 1 cut(s) 43
RseI CAYNNNNRTG 1 cut(s) 107
SaqAI TTAA 1 cut(s) 273
Sau3AI GATC 1 cut(s) 375
Sau96I GGNCC 2 cut(s) 43, 384
ScrFI CCNGG 1 cut(s) 90
SduI GDGCHC 2 cut(s) 90, 334
SetI ASST 6 cut(s) 9, 48, 99, 152, 279, 357
SfaNI GCATC 2 cut(s) 224, 309
SfcI CTRYAG 1 cut(s) 413
SinI GGWCC 1 cut(s) 43
SmiMI CAYNNNNRTG 1 cut(s) 107
SmlI CTYRAG 1 cut(s) 158
SmoI CTYRAG 1 cut(s) 158
SphI GCATGC 1 cut(s) 123
Sse9I AATT 1 cut(s) 127
SspI AATATT 1 cut(s) 205
SspMI CTAG 1 cut(s) 23
StyD4I CCNGG 1 cut(s) 88
TaaI ACNGT 1 cut(s) 185
TasI AATT 1 cut(s) 127
Tru1I TTAA 1 cut(s) 273
Tru9I TTAA 1 cut(s) 273
TscAI CASTG 3 cut(s) 175, 188, 352
TspDTI ATGAA 1 cut(s) 24
TspRI CASTG 3 cut(s) 175, 188, 352
VpaK11BI GGWCC 1 cut(s) 43
XagI CCTNNNNNAGG 1 cut(s) 50
XceI RCATGY 2 cut(s) 20, 123
XmiI GTMKAC 1 cut(s) 29
XspI CTAG 1 cut(s) 23
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.