Rmu_sc0004424.1_g000010

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004424.1
OG0002742
Physical Location & Seq
Forward (+)
39671 .. 39982
312 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004424.1_g000010.1.cds

Sequence Viewer

Length: 312 bp
atgatccttggcgaaaaccgcactttcaacgcctgtttggtggccggagaaggtcggaatagccggaaatcgacgaaacttccaaatttctacagtgagcttcacggctcaaatccgagctcctccagccgagtcatcgaaaaacaccaccgcaggtgtgacaaggaggaggaggcaagcttgccagtgcccggattctgtcgtggggttgccggaggaggaaaggatcagtggaggaaaaatcgggccgaagaggaggaaaggatcgggggagaggagagagaaaactcagtaagtttccaccttttatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

103

Amino Acids

11.56

Weight (kDa)

7.78

Isoelectric Point (pI)

70.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 144
Acc36I ACCTGC 1 cut(s) 144
AciI CCGC 2 cut(s) 19, 151
AclWI GGATC 2 cut(s) 234, 272
AcoI YGGCCR 1 cut(s) 42
AcsI RAATTY 1 cut(s) 85
AfiI CCNNNNNNNGG 1 cut(s) 191
AgsI TTSAA 1 cut(s) 28
AluBI AGCT 3 cut(s) 100, 120, 180
AluI AGCT 3 cut(s) 100, 120, 180
Alw21I GWGCWC 1 cut(s) 122
AlwI GGATC 2 cut(s) 234, 272
AoxI GGCC 2 cut(s) 42, 246
ApoI RAATTY 1 cut(s) 85
AspS9I GGNCC 1 cut(s) 246
AsuC2I CCSGG 1 cut(s) 192
BaeGI GKGCMC 1 cut(s) 192
BanII GRGCYC 1 cut(s) 122
Bbv12I GWGCWC 1 cut(s) 122
BceAI ACGGC 1 cut(s) 121
BcnI CCSGG 1 cut(s) 192
BfmI CTRYAG 1 cut(s) 91
BfuAI ACCTGC 1 cut(s) 144
Bme1390I CCNGG 1 cut(s) 192
BmgT120I GGNCC 1 cut(s) 246
BmrFI CCNGG 1 cut(s) 192
BpmI CTGGAG 1 cut(s) 109
BpuMI CCSGG 1 cut(s) 192
BsaJI CCNNGG 1 cut(s) 7
Bsc4I CCNNNNNNNGG 1 cut(s) 191
Bse1I ACTGG 1 cut(s) 185
BseDI CCNNGG 1 cut(s) 7
BseLI CCNNNNNNNGG 1 cut(s) 191
BseMII CTCAG 1 cut(s) 303
BseNI ACTGG 1 cut(s) 185
BseRI GAGGAG 6 cut(s) 112, 182, 185, 231, 269, 290
BseSI GKGCMC 1 cut(s) 192
BshFI GGCC 2 cut(s) 44, 248
BsiHKAI GWGCWC 1 cut(s) 122
BsiSI CCGG 4 cut(s) 45, 64, 192, 213
BslI CCNNNNNNNGG 1 cut(s) 191
BsnI GGCC 2 cut(s) 44, 248
Bsp1286I GDGCHC 2 cut(s) 122, 192
Bsp143I GATC 3 cut(s) 3, 226, 264
BspACI CCGC 2 cut(s) 19, 151
BspANI GGCC 2 cut(s) 44, 248
BspCNI CTCAG 1 cut(s) 302
BspMI ACCTGC 1 cut(s) 144
BspPI GGATC 2 cut(s) 234, 272
BsrI ACTGG 1 cut(s) 185
BssECI CCNNGG 1 cut(s) 7
BssMI GATC 3 cut(s) 3, 226, 264
BssT1I CCWWGG 1 cut(s) 7
Bst4CI ACNGT 1 cut(s) 95
Bst6I CTCTTC 1 cut(s) 246
BstC8I GCNNGC 2 cut(s) 178, 182
BstDEI CTNAG 1 cut(s) 289
BstKTI GATC 3 cut(s) 6, 229, 267
BstMBI GATC 3 cut(s) 3, 226, 264
BstMWI GCNNNNNNNGC 2 cut(s) 18, 126
BstSCI CCNGG 1 cut(s) 190
BstSFI CTRYAG 1 cut(s) 91
BstSLI GKGCMC 1 cut(s) 192
BsuRI GGCC 2 cut(s) 44, 248
BtsIMutI CAGTG 3 cut(s) 100, 192, 236
BveI ACCTGC 1 cut(s) 144
Cac8I GCNNGC 2 cut(s) 178, 182
Cfr13I GGNCC 1 cut(s) 246
CviJI RGCY 8 cut(s) 44, 63, 100, 108, 120, 129, 180, 248
CviKI_1 RGCY 8 cut(s) 44, 63, 100, 108, 120, 129, 180, 248
DdeI CTNAG 1 cut(s) 289
DpnI GATC 3 cut(s) 5, 228, 266
DpnII GATC 3 cut(s) 3, 226, 264
EaeI YGGCCR 1 cut(s) 42
Eam1104I CTCTTC 1 cut(s) 246
EarI CTCTTC 1 cut(s) 246
Ecl136II GAGCTC 1 cut(s) 120
Eco130I CCWWGG 1 cut(s) 7
Eco24I GRGCYC 1 cut(s) 122
Eco53kI GAGCTC 1 cut(s) 120
EcoICRI GAGCTC 1 cut(s) 120
EcoT14I CCWWGG 1 cut(s) 7
EcoT38I GRGCYC 1 cut(s) 122
ErhI CCWWGG 1 cut(s) 7
FaiI YATR 1 cut(s) 310
FriOI GRGCYC 1 cut(s) 122
GsuI CTGGAG 1 cut(s) 109
HaeIII GGCC 2 cut(s) 44, 248
HapII CCGG 4 cut(s) 45, 64, 192, 213
HindIII AAGCTT 1 cut(s) 178
HinfI GANTC 2 cut(s) 132, 195
HpaII CCGG 4 cut(s) 45, 64, 192, 213
Hpy188I TCNGA 2 cut(s) 57, 117
Hpy99I CGWCG 1 cut(s) 76
HpyAV CCTTC 1 cut(s) 44
HpyCH4III ACNGT 1 cut(s) 95
HpyF10VI GCNNNNNNNGC 2 cut(s) 18, 126
HpyF3I CTNAG 1 cut(s) 289
Kzo9I GATC 3 cut(s) 3, 226, 264
LmnI GCTCC 1 cut(s) 125
LpnPI CCDG 8 cut(s) 46, 58, 77, 139, 139, 198, 205, 226
MaeIII GTNAC 1 cut(s) 158
MalI GATC 3 cut(s) 5, 228, 266
MboI GATC 3 cut(s) 3, 226, 264
MboII GAAGA 1 cut(s) 263
MhlI GDGCHC 2 cut(s) 122, 192
MluCI AATT 1 cut(s) 85
MlyI GAGTC 1 cut(s) 141
MmeI TCCRAC 1 cut(s) 35
MspI CCGG 4 cut(s) 45, 64, 192, 213
MspR9I CCNGG 1 cut(s) 192
MwoI GCNNNNNNNGC 2 cut(s) 18, 126
NciI CCSGG 1 cut(s) 192
NdeII GATC 3 cut(s) 3, 226, 264
NmeAIII GCCGAG 1 cut(s) 155
NmuCI GTSAC 1 cut(s) 158
PaqCI CACCTGC 1 cut(s) 144
PfeI GAWTC 1 cut(s) 195
PleI GAGTC 1 cut(s) 140
PpsI GAGTC 1 cut(s) 140
Psp124BI GAGCTC 1 cut(s) 122
PspPI GGNCC 1 cut(s) 246
SacI GAGCTC 1 cut(s) 122
Sau3AI GATC 3 cut(s) 3, 226, 264
Sau96I GGNCC 1 cut(s) 246
SchI GAGTC 1 cut(s) 141
ScrFI CCNGG 1 cut(s) 192
SduI GDGCHC 2 cut(s) 122, 192
SetI ASST 6 cut(s) 55, 102, 122, 158, 182, 306
SfcI CTRYAG 1 cut(s) 91
Sse9I AATT 1 cut(s) 85
SsiI CCGC 2 cut(s) 19, 151
SstI GAGCTC 1 cut(s) 122
StyD4I CCNGG 1 cut(s) 190
StyI CCWWGG 1 cut(s) 7
TaaI ACNGT 1 cut(s) 95
TaqI TCGA 2 cut(s) 71, 138
TasI AATT 1 cut(s) 85
TfiI GAWTC 1 cut(s) 195
TscAI CASTG 3 cut(s) 100, 192, 236
TseFI GTSAC 1 cut(s) 158
Tsp45I GTSAC 1 cut(s) 158
TspRI CASTG 3 cut(s) 100, 192, 236
XapI RAATTY 1 cut(s) 85
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.