Rmu_sc0010065.1_g000013

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010065.1
Physical Location & Seq
Reverse (-)
48000 .. 48311
312 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010065.1_g000013.1.cds

Sequence Viewer

Length: 312 bp
atgatcattggcaaaaaccgaaccttcgacaccggtttggtggacagagatagccggaatcgccgaaaatcgacgaaagttctaatcggctacagtgaacttcacggctcaaaattaagctcctccagccgaatcactgcaaaacaccaccacagatgtgacaaggaggaagaggcgagcttgctggtgcttggattccttcgtgggtcggccagagaaggaagaaatcggaagaggaagaatcggaccgaagaggagaaaaggatcggggaagaagagagagaaaaatgggtaggtttccaaaaatggtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

103

Amino Acids

12.1

Weight (kDa)

10.27

Isoelectric Point (pI)

51.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 272
AcoI YGGCCR 1 cut(s) 210
AgeI ACCGGT 1 cut(s) 32
AleI CACNNNNGTG 1 cut(s) 156
AluBI AGCT 2 cut(s) 120, 180
AluI AGCT 2 cut(s) 120, 180
AlwI GGATC 1 cut(s) 272
AoxI GGCC 1 cut(s) 210
AsiGI ACCGGT 1 cut(s) 32
AspS9I GGNCC 1 cut(s) 246
AvaII GGWCC 1 cut(s) 246
BceAI ACGGC 1 cut(s) 121
BclI TGATCA 1 cut(s) 3
BfmI CTRYAG 1 cut(s) 91
Bme18I GGWCC 1 cut(s) 246
BmgT120I GGNCC 1 cut(s) 246
BpmI CTGGAG 1 cut(s) 109
BsaWI WCCGGW 1 cut(s) 32
Bse118I RCCGGY 1 cut(s) 32
BseRI GAGGAG 2 cut(s) 112, 269
BshFI GGCC 1 cut(s) 212
BshTI ACCGGT 1 cut(s) 32
BsiSI CCGG 2 cut(s) 33, 55
BsnI GGCC 1 cut(s) 212
Bsp143I GATC 2 cut(s) 3, 264
BspANI GGCC 1 cut(s) 212
BspPI GGATC 1 cut(s) 272
BsrFI RCCGGY 1 cut(s) 32
BssAI RCCGGY 1 cut(s) 32
BssMI GATC 2 cut(s) 3, 264
Bst4CI ACNGT 1 cut(s) 95
Bst6I CTCTTC 4 cut(s) 165, 227, 246, 270
BstC8I GCNNGC 2 cut(s) 178, 182
BstKTI GATC 2 cut(s) 6, 267
BstMBI GATC 2 cut(s) 3, 264
BstMWI GCNNNNNNNGC 2 cut(s) 60, 126
BstSFI CTRYAG 1 cut(s) 91
BsuRI GGCC 1 cut(s) 212
BtsI GCAGTG 1 cut(s) 135
BtsIMutI CAGTG 2 cut(s) 100, 135
Cac8I GCNNGC 2 cut(s) 178, 182
Cfr10I RCCGGY 1 cut(s) 32
Cfr13I GGNCC 1 cut(s) 246
CpoI CGGWCCG 1 cut(s) 246
CspAI ACCGGT 1 cut(s) 32
CspI CGGWCCG 1 cut(s) 246
CviJI RGCY 7 cut(s) 54, 90, 108, 120, 129, 180, 212
CviKI_1 RGCY 7 cut(s) 54, 90, 108, 120, 129, 180, 212
DpnI GATC 2 cut(s) 5, 266
DpnII GATC 2 cut(s) 3, 264
EaeI YGGCCR 1 cut(s) 210
Eam1104I CTCTTC 4 cut(s) 165, 227, 246, 270
EarI CTCTTC 4 cut(s) 165, 227, 246, 270
Eco47I GGWCC 1 cut(s) 246
FbaI TGATCA 1 cut(s) 3
GsuI CTGGAG 1 cut(s) 109
HaeIII GGCC 1 cut(s) 212
HapII CCGG 2 cut(s) 33, 55
HinfI GANTC 4 cut(s) 58, 132, 195, 241
HpaII CCGG 2 cut(s) 33, 55
Hpy166II GTNNAC 2 cut(s) 43, 98
Hpy188I TCNGA 2 cut(s) 231, 246
Hpy8I GTNNAC 2 cut(s) 43, 98
Hpy99I CGWCG 1 cut(s) 76
HpyAV CCTTC 3 cut(s) 34, 209, 212
HpyCH4III ACNGT 1 cut(s) 95
HpyCH4V TGCA 1 cut(s) 140
HpyF10VI GCNNNNNNNGC 2 cut(s) 60, 126
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 2 cut(s) 3, 264
LmnI GCTCC 1 cut(s) 125
LpnPI CCDG 5 cut(s) 46, 68, 139, 170, 226
MaeIII GTNAC 1 cut(s) 158
MalI GATC 2 cut(s) 5, 266
MboI GATC 2 cut(s) 3, 264
MboII GAAGA 7 cut(s) 182, 234, 244, 250, 263, 284, 287
MluCI AATT 1 cut(s) 113
MnlI CCTC 5 cut(s) 133, 160, 166, 228, 247
MseI TTAA 1 cut(s) 116
MslI CAYNNNNRTG 1 cut(s) 156
MspI CCGG 2 cut(s) 33, 55
MwoI GCNNNNNNNGC 2 cut(s) 60, 126
NdeII GATC 2 cut(s) 3, 264
NmuCI GTSAC 1 cut(s) 158
OliI CACNNNNGTG 1 cut(s) 156
PfeI GAWTC 4 cut(s) 58, 132, 195, 241
PinAI ACCGGT 1 cut(s) 32
PspPI GGNCC 1 cut(s) 246
RseI CAYNNNNRTG 1 cut(s) 156
Rsr2I CGGWCCG 1 cut(s) 246
RsrII CGGWCCG 1 cut(s) 246
SaqAI TTAA 1 cut(s) 116
Sau3AI GATC 2 cut(s) 3, 264
Sau96I GGNCC 1 cut(s) 246
SetI ASST 4 cut(s) 26, 122, 182, 298
SfcI CTRYAG 1 cut(s) 91
SinI GGWCC 1 cut(s) 246
SmiMI CAYNNNNRTG 1 cut(s) 156
Sse9I AATT 1 cut(s) 113
TaaI ACNGT 1 cut(s) 95
TaqI TCGA 2 cut(s) 27, 71
TaqII GACCGA 1 cut(s) 263
TasI AATT 1 cut(s) 113
TfiI GAWTC 4 cut(s) 58, 132, 195, 241
Tru1I TTAA 1 cut(s) 116
Tru9I TTAA 1 cut(s) 116
TscAI CASTG 2 cut(s) 100, 142
TseFI GTSAC 1 cut(s) 158
Tsp45I GTSAC 1 cut(s) 158
TspRI CASTG 2 cut(s) 100, 142
VpaK11BI GGWCC 1 cut(s) 246
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.