Rroxscaffold_3G00249000

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
42528529 .. 42532898
4370 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00249000.1

Sequence Viewer

Length: 165 bp
ATGAGGTGTTGGATGACTACGGCTATGAACTGCTCCGGTGTAAGGTGGAACTGTGCAACCGAGATAAAGACAAAGGCTAGGGGCAAAATGATCCTTGGCAAAAACCGAACCTTTAAAGCCGGTTTGGTGGTCGGAGACGGCGGAATCGGAAGATATCGGCGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

54

Amino Acids

6.05

Weight (kDa)

10.98

Isoelectric Point (pI)

43.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 141
AclWI GGATC 1 cut(s) 85
AfiI CCNNNNNNNGG 1 cut(s) 42
Alw26I GTCTC 1 cut(s) 129
AlwI GGATC 1 cut(s) 85
BceAI ACGGC 2 cut(s) 36, 154
BcoDI GTCTC 1 cut(s) 129
BfaI CTAG 1 cut(s) 78
BsaJI CCNNGG 1 cut(s) 94
BsaWI WCCGGW 1 cut(s) 35
Bsc4I CCNNNNNNNGG 1 cut(s) 42
Bse118I RCCGGY 1 cut(s) 119
BseDI CCNNGG 1 cut(s) 94
BseGI GGATG 1 cut(s) 18
BseLI CCNNNNNNNGG 1 cut(s) 42
BsiSI CCGG 2 cut(s) 36, 120
BslI CCNNNNNNNGG 1 cut(s) 42
BsmAI GTCTC 1 cut(s) 129
BsmBI CGTCTC 1 cut(s) 129
Bsp143I GATC 1 cut(s) 90
BspACI CCGC 1 cut(s) 141
BspPI GGATC 1 cut(s) 85
BsrFI RCCGGY 1 cut(s) 119
BssAI RCCGGY 1 cut(s) 119
BssECI CCNNGG 1 cut(s) 94
BssMI GATC 1 cut(s) 90
BssT1I CCWWGG 1 cut(s) 94
Bst4CI ACNGT 1 cut(s) 53
BstF5I GGATG 1 cut(s) 18
BstKTI GATC 1 cut(s) 93
BstMAI GTCTC 1 cut(s) 129
BstMBI GATC 1 cut(s) 90
BtsCI GGATG 1 cut(s) 18
Cfr10I RCCGGY 1 cut(s) 119
CviJI RGCY 3 cut(s) 23, 77, 119
CviKI_1 RGCY 3 cut(s) 23, 77, 119
DpnI GATC 1 cut(s) 92
DpnII GATC 1 cut(s) 90
DraI TTTAAA 1 cut(s) 115
EciI GGCGGA 1 cut(s) 156
Eco130I CCWWGG 1 cut(s) 94
Eco32I GATATC 1 cut(s) 155
EcoRV GATATC 1 cut(s) 155
EcoT14I CCWWGG 1 cut(s) 94
ErhI CCWWGG 1 cut(s) 94
Esp3I CGTCTC 1 cut(s) 129
FaiI YATR 1 cut(s) 26
FokI GGATG 1 cut(s) 25
FspBI CTAG 1 cut(s) 78
HapII CCGG 2 cut(s) 36, 120
HinfI GANTC 1 cut(s) 144
HpaII CCGG 2 cut(s) 36, 120
Hpy188I TCNGA 2 cut(s) 134, 149
HpyCH4III ACNGT 1 cut(s) 53
HpyCH4V TGCA 1 cut(s) 56
Kzo9I GATC 1 cut(s) 90
LmnI GCTCC 1 cut(s) 38
LpnPI CCDG 2 cut(s) 49, 133
MaeI CTAG 1 cut(s) 78
MalI GATC 1 cut(s) 92
MboI GATC 1 cut(s) 90
MboII GAAGA 1 cut(s) 162
MmeI TCCRAC 1 cut(s) 112
MseI TTAA 1 cut(s) 114
MspI CCGG 2 cut(s) 36, 120
NdeII GATC 1 cut(s) 90
PfeI GAWTC 1 cut(s) 144
SaqAI TTAA 1 cut(s) 114
Sau3AI GATC 1 cut(s) 90
SetI ASST 3 cut(s) 8, 47, 113
SgeI CNNG 5 cut(s) 48, 73, 90, 107, 132
SsiI CCGC 1 cut(s) 141
SspMI CTAG 1 cut(s) 78
StyI CCWWGG 1 cut(s) 94
TaaI ACNGT 1 cut(s) 53
TfiI GAWTC 1 cut(s) 144
Tru1I TTAA 1 cut(s) 114
Tru9I TTAA 1 cut(s) 114
TspDTI ATGAA 1 cut(s) 41
XspI CTAG 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.