Rmu_sc0006269.1_g000018

Desiccation-related protein PCC13-62-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006269.1
OG0001867
Physical Location & Seq
Reverse (-)
73975 .. 74506
532 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006269.1_g000018.1.cds

Sequence Viewer

Length: 408 bp
atgcccctcccgaacgtgaatgatactgaccgccttcagtttgctttgaacttggaattcttggaggctgagtttttccagtttggtgctcttggaagagggcttgacagtatcagtccaaatttggccggaggtggtccgcctccttctggtgcgcagaaggcgttgctcaaccctgttgttgctcgaatcatcgaggaattcgtaggagggattccgagacctctgttaaacatcagccgcgaaaattttgcgagaggttttaacggcatagtgggtttcaacctgatccctcctattaatccctatgcaaacacagtcaattatcttttagcagcctattcaatcctttatattggaataggaggctatgttggtagaatccgtaacttactactgttgctgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ferritin_2

Protein Analysis

135

Amino Acids

14.58

Weight (kDa)

6.18

Isoelectric Point (pI)

33.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 156
AccII CGCG 1 cut(s) 243
AciI CCGC 3 cut(s) 31, 140, 241
AclWI GGATC 1 cut(s) 283
AcoI YGGCCR 1 cut(s) 126
AcsI RAATTY 4 cut(s) 56, 121, 200, 247
AcuI CTGAAG 1 cut(s) 20
AfiI CCNNNNNNNGG 1 cut(s) 149
AgsI TTSAA 3 cut(s) 49, 283, 345
Alw21I GWGCWC 1 cut(s) 91
Alw26I GTCTC 1 cut(s) 214
AlwI GGATC 1 cut(s) 283
AoxI GGCC 1 cut(s) 126
ApeKI GCWGC 1 cut(s) 335
ApoI RAATTY 4 cut(s) 56, 121, 200, 247
AseI ATTAAT 1 cut(s) 300
AspLEI GCGC 1 cut(s) 157
AspS9I GGNCC 1 cut(s) 137
AvaII GGWCC 1 cut(s) 137
Bbv12I GWGCWC 1 cut(s) 91
BbvI GCAGC 1 cut(s) 347
BceAI ACGGC 1 cut(s) 283
BcgI CGANNNNNNTGC 2 cut(s) 233, 267
BcoDI GTCTC 1 cut(s) 214
BisI GCNGC 2 cut(s) 241, 336
BlsI GCNGC 2 cut(s) 242, 337
Bme18I GGWCC 1 cut(s) 137
BmgT120I GGNCC 1 cut(s) 137
BsaI GGTCTC 1 cut(s) 214
BsaXI ACNNNNNCTCC 4 cut(s) 56, 86, 357, 387
Bsc4I CCNNNNNNNGG 1 cut(s) 149
Bse1I ACTGG 1 cut(s) 79
BseLI CCNNNNNNNGG 1 cut(s) 149
BseMII CTCAG 1 cut(s) 60
BseNI ACTGG 1 cut(s) 79
BseXI GCAGC 1 cut(s) 347
Bsh1236I CGCG 1 cut(s) 243
BshFI GGCC 1 cut(s) 128
BsiHKAI GWGCWC 1 cut(s) 91
BsiSI CCGG 1 cut(s) 129
BslI CCNNNNNNNGG 1 cut(s) 149
BsmAI GTCTC 1 cut(s) 214
BsnI GGCC 1 cut(s) 128
Bso31I GGTCTC 1 cut(s) 214
Bsp1286I GDGCHC 1 cut(s) 91
Bsp143I GATC 1 cut(s) 288
BspACI CCGC 3 cut(s) 31, 140, 241
BspANI GGCC 1 cut(s) 128
BspCNI CTCAG 1 cut(s) 61
BspFNI CGCG 1 cut(s) 243
BspPI GGATC 1 cut(s) 283
BspTNI GGTCTC 1 cut(s) 214
BsrI ACTGG 1 cut(s) 79
BssMI GATC 1 cut(s) 288
Bst4CI ACNGT 3 cut(s) 110, 319, 399
Bst6I CTCTTC 1 cut(s) 91
BstDEI CTNAG 1 cut(s) 69
BstFNI CGCG 1 cut(s) 243
BstHHI GCGC 1 cut(s) 157
BstKTI GATC 1 cut(s) 291
BstMAI GTCTC 1 cut(s) 214
BstMBI GATC 1 cut(s) 288
BstMWI GCNNNNNNNGC 1 cut(s) 161
BstUI CGCG 1 cut(s) 243
BstV1I GCAGC 1 cut(s) 347
BsuRI GGCC 1 cut(s) 128
CfoI GCGC 1 cut(s) 157
Cfr13I GGNCC 1 cut(s) 137
CviJI RGCY 6 cut(s) 68, 103, 128, 240, 338, 369
CviKI_1 RGCY 6 cut(s) 68, 103, 128, 240, 338, 369
DdeI CTNAG 1 cut(s) 69
DpnI GATC 1 cut(s) 290
DpnII GATC 1 cut(s) 288
EaeI YGGCCR 1 cut(s) 126
Eam1104I CTCTTC 1 cut(s) 91
EarI CTCTTC 1 cut(s) 91
EciI GGCGGA 1 cut(s) 129
Eco31I GGTCTC 1 cut(s) 214
Eco47I GGWCC 1 cut(s) 137
Eco57I CTGAAG 1 cut(s) 20
EcoRI GAATTC 2 cut(s) 56, 200
FaiI YATR 4 cut(s) 272, 309, 354, 372
Fnu4HI GCNGC 2 cut(s) 241, 336
Fsp4HI GCNGC 2 cut(s) 241, 336
FspI TGCGCA 1 cut(s) 156
GlaI GCGC 1 cut(s) 156
GluI GCNGC 2 cut(s) 241, 336
HaeIII GGCC 1 cut(s) 128
HapII CCGG 1 cut(s) 129
HhaI GCGC 1 cut(s) 157
Hin6I GCGC 1 cut(s) 155
HinP1I GCGC 1 cut(s) 155
HinfI GANTC 3 cut(s) 189, 214, 381
HpaII CCGG 1 cut(s) 129
Hpy188I TCNGA 1 cut(s) 219
Hpy188III TCNNGA 1 cut(s) 10
HpyAV CCTTC 3 cut(s) 44, 154, 156
HpyCH4III ACNGT 3 cut(s) 110, 319, 399
HpyCH4IV ACGT 1 cut(s) 15
HpyCH4V TGCA 1 cut(s) 311
HpyF10VI GCNNNNNNNGC 1 cut(s) 161
HpyF3I CTNAG 1 cut(s) 69
HpySE526I ACGT 1 cut(s) 15
HspAI GCGC 1 cut(s) 155
Kzo9I GATC 1 cut(s) 288
LpnPI CCDG 5 cut(s) 92, 135, 142, 189, 299
Lsp1109I GCAGC 1 cut(s) 347
MaeII ACGT 1 cut(s) 15
MaeIII GTNAC 1 cut(s) 386
MalI GATC 1 cut(s) 290
MboI GATC 1 cut(s) 288
MboII GAAGA 1 cut(s) 108
MhlI GDGCHC 1 cut(s) 91
MluCI AATT 5 cut(s) 56, 121, 200, 247, 322
MseI TTAA 3 cut(s) 230, 264, 300
MspI CCGG 1 cut(s) 129
MvnI CGCG 1 cut(s) 243
MwoI GCNNNNNNNGC 1 cut(s) 161
NdeII GATC 1 cut(s) 288
NsbI TGCGCA 1 cut(s) 156
PcsI WCGNNNNNNNCGW 1 cut(s) 201
PfeI GAWTC 3 cut(s) 189, 214, 381
PkrI GCNGC 2 cut(s) 242, 337
PshBI ATTAAT 1 cut(s) 300
PspPI GGNCC 1 cut(s) 137
SaqAI TTAA 3 cut(s) 230, 264, 300
SatI GCNGC 2 cut(s) 241, 336
Sau3AI GATC 1 cut(s) 288
Sau96I GGNCC 1 cut(s) 137
SduI GDGCHC 1 cut(s) 91
SetI ASST 5 cut(s) 18, 136, 226, 262, 288
SinI GGWCC 1 cut(s) 137
Sse9I AATT 5 cut(s) 56, 121, 200, 247, 322
SsiI CCGC 3 cut(s) 31, 140, 241
TaaI ACNGT 3 cut(s) 110, 319, 399
TaiI ACGT 1 cut(s) 18
TaqI TCGA 2 cut(s) 187, 195
TasI AATT 5 cut(s) 56, 121, 200, 247, 322
TauI GCSGC 1 cut(s) 243
TfiI GAWTC 3 cut(s) 189, 214, 381
Tru1I TTAA 3 cut(s) 230, 264, 300
Tru9I TTAA 3 cut(s) 230, 264, 300
TseI GCWGC 1 cut(s) 335
TspGWI ACGGA 1 cut(s) 374
VpaK11BI GGWCC 1 cut(s) 137
VspI ATTAAT 1 cut(s) 300
XapI RAATTY 4 cut(s) 56, 121, 200, 247
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.