Rmu_sc0010228.1_g000005

Belongs to the sulfotransferase 1 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010228.1
OG0001120
Physical Location & Seq
Forward (+)
19444 .. 19740
297 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010228.1_g000005.1.cds

Sequence Viewer

Length: 297 bp
atgaaagaaaaacctggtctgcagttgaggagactaactgaattcttgggctgcccattttcaccgaaagaagaggcacagggagtggtggacaatatcttaaggctgtgtacttttgagaatttgagcaatttgcatgtgaacaaaaatgagaaattatcgacagggatggagaatagtgcattcttttggcgaggggaggcgggggagtggaggaattatttgacagctgagatggtggaacagctagaccgtatcattgaagagaagttgcaaggttctgacttgaaattctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Sulfotransfer_1

Protein Analysis

98

Amino Acids

11.36

Weight (kDa)

5.21

Isoelectric Point (pI)

54.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 203
AcsI RAATTY 3 cut(s) 41, 121, 290
AfaI GTAC 1 cut(s) 112
AflII CTTAAG 1 cut(s) 100
AgsI TTSAA 2 cut(s) 263, 289
AjnI CCWGG 1 cut(s) 13
AluBI AGCT 2 cut(s) 230, 247
AluI AGCT 2 cut(s) 230, 247
Alw26I GTCTC 1 cut(s) 25
ApeKI GCWGC 1 cut(s) 51
ApoI RAATTY 3 cut(s) 41, 121, 290
AsuHPI GGTGA 1 cut(s) 54
BbvI GCAGC 1 cut(s) 38
BccI CCATC 2 cut(s) 163, 229
BciT130I CCWGG 1 cut(s) 15
BcoDI GTCTC 1 cut(s) 25
BfaI CTAG 1 cut(s) 248
BfmI CTRYAG 1 cut(s) 20
BfrI CTTAAG 1 cut(s) 100
BisI GCNGC 1 cut(s) 52
BlsI GCNGC 1 cut(s) 53
Bme1390I CCNGG 1 cut(s) 15
BmrFI CCNGG 1 cut(s) 15
BseBI CCWGG 1 cut(s) 15
BseGI GGATG 1 cut(s) 174
BseMII CTCAG 1 cut(s) 222
BseRI GAGGAG 1 cut(s) 43
BseXI GCAGC 1 cut(s) 38
BsmAI GTCTC 1 cut(s) 25
BsmI GAATGC 1 cut(s) 182
BspACI CCGC 1 cut(s) 203
BspCNI CTCAG 1 cut(s) 223
BspMAI CTGCAG 1 cut(s) 24
BspTI CTTAAG 1 cut(s) 100
Bst2UI CCWGG 1 cut(s) 15
Bst4CI ACNGT 1 cut(s) 254
Bst6I CTCTTC 2 cut(s) 66, 258
BstAFI CTTAAG 1 cut(s) 100
BstDEI CTNAG 1 cut(s) 231
BstF5I GGATG 1 cut(s) 174
BstMAI GTCTC 1 cut(s) 25
BstNI CCWGG 1 cut(s) 15
BstNSI RCATGY 1 cut(s) 140
BstSCI CCNGG 1 cut(s) 13
BstSFI CTRYAG 1 cut(s) 20
BstV1I GCAGC 1 cut(s) 38
BtsCI GGATG 1 cut(s) 174
CsiI ACCWGGT 1 cut(s) 13
Csp6I GTAC 1 cut(s) 111
CviAII CATG 1 cut(s) 137
CviJI RGCY 4 cut(s) 51, 106, 230, 247
CviKI_1 RGCY 4 cut(s) 51, 106, 230, 247
CviQI GTAC 1 cut(s) 111
DdeI CTNAG 1 cut(s) 231
Eam1104I CTCTTC 2 cut(s) 66, 258
EarI CTCTTC 2 cut(s) 66, 258
EcoRI GAATTC 1 cut(s) 41
EcoRII CCWGG 1 cut(s) 13
FaeI CATG 1 cut(s) 140
FaiI YATR 1 cut(s) 138
FatI CATG 1 cut(s) 136
FauI CCCGC 1 cut(s) 196
Fnu4HI GCNGC 1 cut(s) 52
FokI GGATG 1 cut(s) 181
Fsp4HI GCNGC 1 cut(s) 52
FspBI CTAG 1 cut(s) 248
GluI GCNGC 1 cut(s) 52
Hin1II CATG 1 cut(s) 140
HphI GGTGA 1 cut(s) 54
Hpy166II GTNNAC 3 cut(s) 91, 111, 142
Hpy188I TCNGA 1 cut(s) 283
Hpy8I GTNNAC 3 cut(s) 91, 111, 142
HpyCH4III ACNGT 1 cut(s) 254
HpyCH4V TGCA 4 cut(s) 22, 136, 182, 274
HpyF3I CTNAG 1 cut(s) 231
Hsp92II CATG 1 cut(s) 140
LpnPI CCDG 3 cut(s) 27, 65, 150
Lsp1109I GCAGC 1 cut(s) 38
MabI ACCWGGT 1 cut(s) 13
MaeI CTAG 1 cut(s) 248
MboII GAAGA 2 cut(s) 83, 275
MluCI AATT 6 cut(s) 41, 121, 130, 155, 217, 290
MnlI CCTC 5 cut(s) 21, 67, 188, 193, 207
MseI TTAA 1 cut(s) 101
MspA1I CMGCKG 1 cut(s) 230
MspCI CTTAAG 1 cut(s) 100
MspR9I CCNGG 1 cut(s) 15
Mva1269I GAATGC 1 cut(s) 182
MvaI CCWGG 1 cut(s) 15
NlaIII CATG 1 cut(s) 140
NspI RCATGY 1 cut(s) 140
PctI GAATGC 1 cut(s) 182
PkrI GCNGC 1 cut(s) 53
Psp6I CCWGG 1 cut(s) 13
PspGI CCWGG 1 cut(s) 13
PstI CTGCAG 1 cut(s) 24
PvuII CAGCTG 1 cut(s) 230
RsaI GTAC 1 cut(s) 112
RsaNI GTAC 1 cut(s) 111
SaqAI TTAA 1 cut(s) 101
SatI GCNGC 1 cut(s) 52
ScrFI CCNGG 1 cut(s) 15
SetI ASST 4 cut(s) 16, 232, 249, 280
SexAI ACCWGGT 1 cut(s) 13
SfcI CTRYAG 1 cut(s) 20
SmlI CTYRAG 1 cut(s) 100
SmoI CTYRAG 1 cut(s) 100
Sse9I AATT 6 cut(s) 41, 121, 130, 155, 217, 290
SsiI CCGC 1 cut(s) 203
SspMI CTAG 1 cut(s) 248
StyD4I CCNGG 1 cut(s) 13
TaaI ACNGT 1 cut(s) 254
TaqI TCGA 1 cut(s) 161
TasI AATT 6 cut(s) 41, 121, 130, 155, 217, 290
TatI WGTACW 1 cut(s) 110
Tru1I TTAA 1 cut(s) 101
Tru9I TTAA 1 cut(s) 101
TseI GCWGC 1 cut(s) 51
TspDTI ATGAA 1 cut(s) 17
Vha464I CTTAAG 1 cut(s) 100
XapI RAATTY 3 cut(s) 41, 121, 290
XceI RCATGY 1 cut(s) 140
XspI CTAG 1 cut(s) 248
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.