Rmu_sc0011602.1_g000006

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011602.1
Physical Location & Seq
Reverse (-)
30174 .. 30760
587 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011602.1_g000006.1.cds

Sequence Viewer

Length: 498 bp
atggcatcaacaattggtcgtttgtttcaagatcaaaatctcagtgttcactctaatggaaattctgctgtaggaaagggtggtgcaaaaacacagaagaaagttgggtttggtggaaggaaacctctaggagatgtatcgaacactgggaagcctgatttttccaacgtgtcgaaaaagcctgcttttaccaatgtttctgaaatcattactgatgcaagcaacaagaaaggcctttctaaagcctcggataaagtgcagactcgtggcaatcggaaggcactatttgatgtgtctaacatagtcaagccacctgtgcataagaagtcatgtgttgcggcacaaccaccttgtggttttgaggaggaaggtttcctgcatgaccatcaacagtgcatcaaatctatgagaaaggctaatcacatggatcaaatggattttttgatacaaggatcagattcatccaagaagcttctgtctccatgtgcagtttcttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

165

Amino Acids

17.69

Weight (kDa)

9.7

Isoelectric Point (pI)

22.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 353
AciI CCGC 1 cut(s) 338
AclWI GGATC 2 cut(s) 435, 460
AcsI RAATTY 1 cut(s) 61
AdeI CACNNNGTG 1 cut(s) 353
AfiI CCNNNNNNNGG 1 cut(s) 353
AflIII ACRYGT 1 cut(s) 168
AgsI TTSAA 1 cut(s) 29
AluBI AGCT 1 cut(s) 472
AluI AGCT 1 cut(s) 472
Alw26I GTCTC 1 cut(s) 483
AlwI GGATC 2 cut(s) 435, 460
AoxI GGCC 1 cut(s) 232
ApoI RAATTY 1 cut(s) 61
BauI CACGAG 1 cut(s) 264
BccI CCATC 1 cut(s) 393
BcoDI GTCTC 1 cut(s) 483
BfaI CTAG 1 cut(s) 128
BfmI CTRYAG 1 cut(s) 69
BisI GCNGC 1 cut(s) 339
BlsI GCNGC 1 cut(s) 340
BmrI ACTGGG 1 cut(s) 156
BmsI GCATC 3 cut(s) 14, 205, 405
BmuI ACTGGG 1 cut(s) 156
BsaBI GATNNNNATC 1 cut(s) 36
BsaJI CCNNGG 1 cut(s) 246
Bsc4I CCNNNNNNNGG 1 cut(s) 353
Bse1I ACTGG 1 cut(s) 151
Bse8I GATNNNNATC 1 cut(s) 36
BseDI CCNNGG 1 cut(s) 246
BseGI GGATG 1 cut(s) 461
BseJI GATNNNNATC 1 cut(s) 36
BseLI CCNNNNNNNGG 1 cut(s) 353
BseMII CTCAG 1 cut(s) 55
BseNI ACTGG 1 cut(s) 151
BseRI GAGGAG 1 cut(s) 377
BsgI GTGCAG 1 cut(s) 278
BshFI GGCC 1 cut(s) 234
BslI CCNNNNNNNGG 1 cut(s) 353
BsmAI GTCTC 1 cut(s) 483
BsnI GGCC 1 cut(s) 234
Bsp143I GATC 3 cut(s) 31, 427, 452
BspACI CCGC 1 cut(s) 338
BspANI GGCC 1 cut(s) 234
BspCNI CTCAG 1 cut(s) 54
BspPI GGATC 2 cut(s) 435, 460
BsrI ACTGG 1 cut(s) 151
BssECI CCNNGG 1 cut(s) 246
BssMI GATC 3 cut(s) 31, 427, 452
BssSI CACGAG 1 cut(s) 264
Bst2BI CACGAG 1 cut(s) 264
Bst4CI ACNGT 1 cut(s) 393
BstC8I GCNNGC 2 cut(s) 183, 220
BstDEI CTNAG 2 cut(s) 41, 495
BstF5I GGATG 1 cut(s) 461
BstKTI GATC 3 cut(s) 34, 430, 455
BstMAI GTCTC 1 cut(s) 483
BstMBI GATC 3 cut(s) 31, 427, 452
BstMWI GCNNNNNNNGC 1 cut(s) 316
BstSFI CTRYAG 1 cut(s) 69
BsuRI GGCC 1 cut(s) 234
BtsCI GGATG 1 cut(s) 461
BtsIMutI CAGTG 3 cut(s) 49, 144, 398
Cac8I GCNNGC 2 cut(s) 183, 220
CviAII CATG 4 cut(s) 330, 380, 424, 483
CviJI RGCY 7 cut(s) 154, 181, 234, 245, 310, 416, 472
CviKI_1 RGCY 7 cut(s) 154, 181, 234, 245, 310, 416, 472
DdeI CTNAG 2 cut(s) 41, 495
DpnI GATC 3 cut(s) 33, 429, 454
DpnII GATC 3 cut(s) 31, 427, 452
DraIII CACNNNGTG 1 cut(s) 353
Eco147I AGGCCT 1 cut(s) 234
FaeI CATG 4 cut(s) 333, 383, 427, 486
FaiI YATR 7 cut(s) 302, 321, 331, 381, 407, 425, 484
FatI CATG 4 cut(s) 329, 379, 423, 482
Fnu4HI GCNGC 1 cut(s) 339
FokI GGATG 1 cut(s) 448
Fsp4HI GCNGC 1 cut(s) 339
FspBI CTAG 1 cut(s) 128
GluI GCNGC 1 cut(s) 339
HaeIII GGCC 1 cut(s) 234
Hin1II CATG 4 cut(s) 333, 383, 427, 486
HindIII AAGCTT 1 cut(s) 470
HinfI GANTC 2 cut(s) 262, 458
Hpy166II GTNNAC 1 cut(s) 49
Hpy188I TCNGA 4 cut(s) 202, 250, 276, 457
Hpy188III TCNNGA 1 cut(s) 29
Hpy8I GTNNAC 1 cut(s) 49
HpyAV CCTTC 3 cut(s) 111, 271, 362
HpyCH4III ACNGT 1 cut(s) 393
HpyCH4IV ACGT 1 cut(s) 168
HpyCH4V TGCA 7 cut(s) 86, 218, 259, 319, 379, 396, 488
HpyF10VI GCNNNNNNNGC 1 cut(s) 316
HpyF3I CTNAG 2 cut(s) 41, 495
HpySE526I ACGT 1 cut(s) 168
Hsp92II CATG 4 cut(s) 333, 383, 427, 486
Kzo9I GATC 3 cut(s) 31, 427, 452
LpnPI CCDG 5 cut(s) 132, 168, 195, 327, 389
LweI GCATC 3 cut(s) 14, 205, 405
MaeI CTAG 1 cut(s) 128
MaeII ACGT 1 cut(s) 168
MalI GATC 3 cut(s) 33, 429, 454
MboI GATC 3 cut(s) 31, 427, 452
MboII GAAGA 1 cut(s) 109
MfeI CAATTG 1 cut(s) 12
MluCI AATT 2 cut(s) 12, 61
MlyI GAGTC 1 cut(s) 256
MmeI TCCRAC 1 cut(s) 189
MnlI CCTC 4 cut(s) 135, 256, 355, 358
MslI CAYNNNNRTG 1 cut(s) 54
MunI CAATTG 1 cut(s) 12
MwoI GCNNNNNNNGC 1 cut(s) 316
NdeII GATC 3 cut(s) 31, 427, 452
NlaIII CATG 4 cut(s) 333, 383, 427, 486
PceI AGGCCT 1 cut(s) 234
PfeI GAWTC 1 cut(s) 458
PflMI CCANNNNNTGG 1 cut(s) 353
PkrI GCNGC 1 cut(s) 340
PleI GAGTC 1 cut(s) 256
PpsI GAGTC 1 cut(s) 256
RseI CAYNNNNRTG 1 cut(s) 54
SatI GCNGC 1 cut(s) 339
Sau3AI GATC 3 cut(s) 31, 427, 452
SchI GAGTC 1 cut(s) 256
SetI ASST 6 cut(s) 127, 171, 316, 352, 373, 474
SfaNI GCATC 3 cut(s) 14, 205, 405
SfcI CTRYAG 1 cut(s) 69
SmiMI CAYNNNNRTG 1 cut(s) 54
Sse9I AATT 2 cut(s) 12, 61
SseBI AGGCCT 1 cut(s) 234
SsiI CCGC 1 cut(s) 338
SspMI CTAG 1 cut(s) 128
StuI AGGCCT 1 cut(s) 234
TaaI ACNGT 1 cut(s) 393
TaiI ACGT 1 cut(s) 171
TaqI TCGA 2 cut(s) 140, 173
TasI AATT 2 cut(s) 12, 61
TauI GCSGC 1 cut(s) 341
TfiI GAWTC 1 cut(s) 458
TscAI CASTG 3 cut(s) 49, 151, 398
TspDTI ATGAA 1 cut(s) 450
TspRI CASTG 3 cut(s) 49, 151, 398
Van91I CCANNNNNTGG 1 cut(s) 353
XapI RAATTY 1 cut(s) 61
XspI CTAG 1 cut(s) 128
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.