Rmu_sc0014136.1_g000011
ERF Family

negative regulation of interferon-beta production

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0014136.1
Physical Location & Seq
Forward (+)
45952 .. 46659
708 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0014136.1_g000011.1.cds

Sequence Viewer

Length: 708 bp
atgacattgctcaccatcaatgctttcaatcgatgctctgtgagttggaacggtctactatggaggtctgttgatacctcgtcccagaccccactacgtgatgatgatgcgcttaagatcgaatttatgttcctcaacgaaacccaacacgcttttacaccagatagagatactcaagatcagataaaaacaaagagagatactcaagaaacttgggtgatcccccacacaacaacaacaaaggccattacagtccgtccttccgagttatacaaccacgattctactagtattatgcaatcctcttcagggcgtatgctcgtagactttattaacgcccattttcctcctcgagacaaattagatctccccaaagttgtggcagatatactttatcttgttcaaaactccattcccttggttcctaatgatttcattcatgtgcgacgatttacagggattgaaataatgcatcatcttgatgatgaagtgactagagcggacctacataatcgttttgaagctacgaaactcgggacatgtgctatttgtttggatgattttgaggttggacgtaacactagtcgattgccttgcttgcacgtttttcatggaccttgcattgttaagtggctggagatcgatcctcattgtcctctttgccgatgttctctggcccctgaactagcaccatggtttaatgcataa

Protein Analysis

235

Amino Acids

26.94

Weight (kDa)

5.84

Isoelectric Point (pI)

32.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 500
AccI GTMKAC 2 cut(s) 55, 324
AciI CCGC 1 cut(s) 500
AclWI GGATC 2 cut(s) 214, 638
AcsI RAATTY 1 cut(s) 122
AcuI CTGAAG 1 cut(s) 291
AdeI CACNNNGTG 1 cut(s) 98
AfiI CCNNNNNNNGG 1 cut(s) 309
AflII CTTAAG 1 cut(s) 113
AflIII ACRYGT 1 cut(s) 539
AgsI TTSAA 4 cut(s) 28, 404, 464, 521
AhlI ACTAGT 2 cut(s) 287, 581
AluBI AGCT 1 cut(s) 524
AluI AGCT 1 cut(s) 524
Alw26I GTCTC 1 cut(s) 348
AlwI GGATC 2 cut(s) 214, 638
Ama87I CYCGRG 2 cut(s) 351, 533
AoxI GGCC 2 cut(s) 243, 675
ApoI RAATTY 1 cut(s) 122
AspLEI GCGC 1 cut(s) 112
AspS9I GGNCC 3 cut(s) 502, 614, 676
AsuHPI GGTGA 2 cut(s) 4, 229
AvaI CYCGRG 2 cut(s) 351, 533
AvaII GGWCC 2 cut(s) 502, 614
BccI CCATC 1 cut(s) 23
BcgI CGANNNNNNTGC 2 cut(s) 576, 610
BcoDI GTCTC 1 cut(s) 348
BcuI ACTAGT 2 cut(s) 287, 581
BfaI CTAG 4 cut(s) 288, 495, 582, 686
BfrI CTTAAG 1 cut(s) 113
BglII AGATCT 1 cut(s) 364
Bme18I GGWCC 2 cut(s) 502, 614
BmeT110I CYCGRG 2 cut(s) 351, 533
BmgT120I GGNCC 3 cut(s) 502, 614, 676
BmiI GGNNCC 2 cut(s) 423, 678
BmsI GCATC 3 cut(s) 23, 97, 481
BplI GAGNNNNNCTC 2 cut(s) 187, 219
BpmI CTGGAG 1 cut(s) 656
BpuEI CTTGAG 2 cut(s) 159, 189
Bsa29I ATCGAT 2 cut(s) 31, 642
BsaAI YACGTR 1 cut(s) 98
BsaJI CCNNGG 2 cut(s) 417, 692
Bsc4I CCNNNNNNNGG 1 cut(s) 309
Bse3DI GCAATG 1 cut(s) 5
BseCI ATCGAT 2 cut(s) 31, 642
BseDI CCNNGG 2 cut(s) 417, 692
BseGI GGATG 1 cut(s) 562
BseLI CCNNNNNNNGG 1 cut(s) 309
BseMI GCAATG 1 cut(s) 5
BseRI GAGGAG 1 cut(s) 339
BshFI GGCC 2 cut(s) 245, 677
BshVI ATCGAT 2 cut(s) 31, 642
BsiHKCI CYCGRG 2 cut(s) 351, 533
BslFI GGGAC 2 cut(s) 67, 550
BslI CCNNNNNNNGG 1 cut(s) 309
BsmAI GTCTC 1 cut(s) 348
BsmFI GGGAC 2 cut(s) 67, 550
BsnI GGCC 2 cut(s) 245, 677
BsoBI CYCGRG 2 cut(s) 351, 533
Bsp143I GATC 6 cut(s) 117, 178, 219, 364, 639, 643
Bsp19I CCATGG 1 cut(s) 692
BspACI CCGC 1 cut(s) 500
BspANI GGCC 2 cut(s) 245, 677
BspDI ATCGAT 2 cut(s) 31, 642
BspLI GGNNCC 2 cut(s) 423, 678
BspPI GGATC 2 cut(s) 214, 638
BspTI CTTAAG 1 cut(s) 113
BsrBI CCGCTC 1 cut(s) 500
BsrDI GCAATG 1 cut(s) 5
BssECI CCNNGG 2 cut(s) 417, 692
BssMI GATC 6 cut(s) 117, 178, 219, 364, 639, 643
BssT1I CCWWGG 2 cut(s) 417, 692
Bst4CI ACNGT 2 cut(s) 53, 253
Bst6I CTCTTC 1 cut(s) 310
BstAFI CTTAAG 1 cut(s) 113
BstBAI YACGTR 1 cut(s) 98
BstC8I GCNNGC 1 cut(s) 599
BstDSI CCRYGG 1 cut(s) 692
BstF5I GGATG 1 cut(s) 562
BstHHI GCGC 1 cut(s) 112
BstKTI GATC 6 cut(s) 120, 181, 222, 367, 642, 646
BstMAI GTCTC 1 cut(s) 348
BstMBI GATC 6 cut(s) 117, 178, 219, 364, 639, 643
BstMWI GCNNNNNNNGC 1 cut(s) 598
BstNSI RCATGY 1 cut(s) 543
BstX2I RGATCY 1 cut(s) 364
BstXI CCANNNNNNTGG 2 cut(s) 379, 418
BstYI RGATCY 1 cut(s) 364
Bsu15I ATCGAT 2 cut(s) 31, 642
BsuRI GGCC 2 cut(s) 245, 677
BsuTUI ATCGAT 2 cut(s) 31, 642
BtgI CCRYGG 1 cut(s) 692
BtsCI GGATG 1 cut(s) 562
Cac8I GCNNGC 1 cut(s) 599
CfoI GCGC 1 cut(s) 112
Cfr13I GGNCC 3 cut(s) 502, 614, 676
ClaI ATCGAT 2 cut(s) 31, 642
CviAII CATG 4 cut(s) 440, 540, 611, 693
CviJI RGCY 4 cut(s) 245, 524, 634, 677
CviKI_1 RGCY 4 cut(s) 245, 524, 634, 677
DpnI GATC 6 cut(s) 119, 180, 221, 366, 641, 645
DpnII GATC 6 cut(s) 117, 178, 219, 364, 639, 643
DraIII CACNNNGTG 1 cut(s) 98
Eam1104I CTCTTC 1 cut(s) 310
EarI CTCTTC 1 cut(s) 310
Eco130I CCWWGG 2 cut(s) 417, 692
Eco47I GGWCC 2 cut(s) 502, 614
Eco57I CTGAAG 1 cut(s) 291
Eco88I CYCGRG 2 cut(s) 351, 533
EcoT14I CCWWGG 2 cut(s) 417, 692
EcoT22I ATGCAT 2 cut(s) 474, 706
ErhI CCWWGG 2 cut(s) 417, 692
FaeI CATG 4 cut(s) 443, 543, 614, 696
FaqI GGGAC 2 cut(s) 67, 550
FatI CATG 4 cut(s) 439, 539, 610, 692
FblI GTMKAC 2 cut(s) 55, 324
FokI GGATG 1 cut(s) 569
FspBI CTAG 4 cut(s) 288, 495, 582, 686
GlaI GCGC 1 cut(s) 111
GsuI CTGGAG 1 cut(s) 656
HaeIII GGCC 2 cut(s) 245, 677
HhaI GCGC 1 cut(s) 112
Hin1II CATG 4 cut(s) 443, 543, 614, 696
Hin6I GCGC 1 cut(s) 110
HinP1I GCGC 1 cut(s) 110
HinfI GANTC 1 cut(s) 281
HphI GGTGA 2 cut(s) 4, 229
Hpy166II GTNNAC 2 cut(s) 56, 325
Hpy188I TCNGA 2 cut(s) 183, 265
Hpy188III TCNNGA 5 cut(s) 176, 206, 353, 479, 535
Hpy8I GTNNAC 2 cut(s) 56, 325
Hpy99I CGWCG 1 cut(s) 450
HpyAV CCTTC 1 cut(s) 270
HpyCH4III ACNGT 2 cut(s) 53, 253
HpyCH4IV ACGT 3 cut(s) 97, 574, 603
HpyCH4V TGCA 5 cut(s) 298, 472, 601, 621, 704
HpyF10VI GCNNNNNNNGC 1 cut(s) 598
HpySE526I ACGT 3 cut(s) 97, 574, 603
Hsp92II CATG 4 cut(s) 443, 543, 614, 696
HspAI GCGC 1 cut(s) 110
Kzo9I GATC 6 cut(s) 117, 178, 219, 364, 639, 643
LpnPI CCDG 7 cut(s) 98, 174, 294, 441, 620, 659, 693
LweI GCATC 3 cut(s) 23, 97, 481
MaeI CTAG 4 cut(s) 288, 495, 582, 686
MaeII ACGT 3 cut(s) 97, 574, 603
MaeIII GTNAC 2 cut(s) 490, 575
MalI GATC 6 cut(s) 119, 180, 221, 366, 641, 645
MbiI CCGCTC 1 cut(s) 500
MboI GATC 6 cut(s) 117, 178, 219, 364, 639, 643
MboII GAAGA 1 cut(s) 297
MflI RGATCY 1 cut(s) 364
MluCI AATT 2 cut(s) 122, 359
MmeI TCCRAC 2 cut(s) 26, 550
MnlI CCTC 9 cut(s) 57, 88, 143, 313, 357, 360, 559, 657, 666
Mph1103I ATGCAT 2 cut(s) 474, 706
MseI TTAA 4 cut(s) 114, 333, 627, 699
MslI CAYNNNNRTG 2 cut(s) 440, 480
MspCI CTTAAG 1 cut(s) 113
MwoI GCNNNNNNNGC 1 cut(s) 598
NcoI CCATGG 1 cut(s) 692
NdeII GATC 6 cut(s) 117, 178, 219, 364, 639, 643
NlaIII CATG 4 cut(s) 443, 543, 614, 696
NlaIV GGNNCC 2 cut(s) 423, 678
NmuCI GTSAC 1 cut(s) 490
NsiI ATGCAT 2 cut(s) 474, 706
NspI RCATGY 1 cut(s) 543
PaeR7I CTCGAG 1 cut(s) 351
PciI ACATGT 1 cut(s) 539
PfeI GAWTC 1 cut(s) 281
Ppu21I YACGTR 1 cut(s) 98
PscI ACATGT 1 cut(s) 539
PspN4I GGNNCC 2 cut(s) 423, 678
PspPI GGNCC 3 cut(s) 502, 614, 676
PsuI RGATCY 1 cut(s) 364
RseI CAYNNNNRTG 2 cut(s) 440, 480
SaqAI TTAA 4 cut(s) 114, 333, 627, 699
Sau3AI GATC 6 cut(s) 117, 178, 219, 364, 639, 643
Sau96I GGNCC 3 cut(s) 502, 614, 676
SetI ASST 9 cut(s) 68, 80, 100, 507, 526, 570, 577, 606, 619
SfaNI GCATC 3 cut(s) 23, 97, 481
Sfr274I CTCGAG 1 cut(s) 351
SinI GGWCC 2 cut(s) 502, 614
SlaI CTCGAG 1 cut(s) 351
SmiMI CAYNNNNRTG 2 cut(s) 440, 480
SmlI CTYRAG 4 cut(s) 113, 174, 204, 351
SmoI CTYRAG 4 cut(s) 113, 174, 204, 351
SpeI ACTAGT 2 cut(s) 287, 581
Sse9I AATT 2 cut(s) 122, 359
SsiI CCGC 1 cut(s) 500
SspMI CTAG 4 cut(s) 288, 495, 582, 686
StyI CCWWGG 2 cut(s) 417, 692
TaaI ACNGT 2 cut(s) 53, 253
TaiI ACGT 3 cut(s) 100, 577, 606
TaqI TCGA 5 cut(s) 31, 120, 352, 586, 642
TasI AATT 2 cut(s) 122, 359
TfiI GAWTC 1 cut(s) 281
Tru1I TTAA 4 cut(s) 114, 333, 627, 699
Tru9I TTAA 4 cut(s) 114, 333, 627, 699
TseFI GTSAC 1 cut(s) 490
Tsp45I GTSAC 1 cut(s) 490
TspDTI ATGAA 4 cut(s) 424, 428, 501, 599
TspGWI ACGGA 1 cut(s) 245
Vha464I CTTAAG 1 cut(s) 113
VpaK11BI GGWCC 2 cut(s) 502, 614
XapI RAATTY 1 cut(s) 122
XceI RCATGY 1 cut(s) 543
XhoI CTCGAG 1 cut(s) 351
XmiI GTMKAC 2 cut(s) 55, 324
XspI CTAG 4 cut(s) 288, 495, 582, 686
Zsp2I ATGCAT 2 cut(s) 474, 706
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.