Rroxscaffold_2G00149520
ERF Family

negative regulation of interferon-beta production

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
87076883 .. 87079930
3048 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00149520.1

Sequence Viewer

Length: 378 bp
ATGAAGACAGAGATACTTAATCAGGTTGAAGGGCTTGTATTCTGTGGAGAATTTTGGCGATATAAAAGTATTGGAACCAAATATGAACACGGGCTGGAAGAAACCAGAATAAGGTCTAGGTTTTCTGTCACCTCTGCCGATATGTGTGCTAAGAATCCACCAAGCGATGATACACTAAAGATCCGATTTATCTTCTTCAAGCATACCTGTCATGGTTTGGGAACACGTGTAGATATTCGTGAAAATTTTCATATCCCTCAAAGTGAAAAGTTCATCACGATTCCTCCTTCTGAGTATTGTAATAAGGATCATACTAGAATTATGCAATCTTCTTCAATACGTATGCTCGTGGACTTTATTAAGACTGAGTTGCATTAG

Protein Analysis

125

Amino Acids

14.66

Weight (kDa)

8.38

Isoelectric Point (pI)

33.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 175, 315
AcsI RAATTY 2 cut(s) 50, 244
AcvI CACGTG 1 cut(s) 227
AfiI CCNNNNNNNGG 1 cut(s) 111
AflIII ACRYGT 2 cut(s) 224, 226
AgsI TTSAA 3 cut(s) 29, 199, 336
AlwI GGATC 2 cut(s) 175, 315
ApoI RAATTY 2 cut(s) 50, 244
Asp700I GAANNNNTTC 1 cut(s) 246
AsuHPI GGTGA 1 cut(s) 121
BauI CACGAG 1 cut(s) 347
BbrPI CACGTG 1 cut(s) 227
BbsI GAAGAC 1 cut(s) 11
BcgI CGANNNNNNTGC 2 cut(s) 128, 162
BfaI CTAG 2 cut(s) 117, 315
BmiI GGNNCC 1 cut(s) 76
BpiI GAAGAC 1 cut(s) 11
BsaAI YACGTR 2 cut(s) 227, 341
BsaXI ACNNNNNCTCC 2 cut(s) 268, 298
Bsc4I CCNNNNNNNGG 1 cut(s) 111
BseLI CCNNNNNNNGG 1 cut(s) 111
BseMII CTCAG 2 cut(s) 282, 357
BslI CCNNNNNNNGG 1 cut(s) 111
Bsp143I GATC 2 cut(s) 180, 307
BspCNI CTCAG 2 cut(s) 283, 358
BspLI GGNNCC 1 cut(s) 76
BspPI GGATC 2 cut(s) 175, 315
BssMI GATC 2 cut(s) 180, 307
BssSI CACGAG 1 cut(s) 347
Bst2BI CACGAG 1 cut(s) 347
BstBAI YACGTR 2 cut(s) 227, 341
BstDEI CTNAG 3 cut(s) 150, 291, 366
BstKTI GATC 2 cut(s) 183, 310
BstMBI GATC 2 cut(s) 180, 307
BstSNI TACGTA 1 cut(s) 341
BstV2I GAAGAC 1 cut(s) 11
BstX2I RGATCY 1 cut(s) 180
BstYI RGATCY 1 cut(s) 180
BtgZI GCGATG 1 cut(s) 180
CviAII CATG 1 cut(s) 212
CviJI RGCY 2 cut(s) 34, 94
CviKI_1 RGCY 2 cut(s) 34, 94
DdeI CTNAG 3 cut(s) 150, 291, 366
DpnI GATC 2 cut(s) 182, 309
DpnII GATC 2 cut(s) 180, 307
Eco105I TACGTA 1 cut(s) 341
Eco72I CACGTG 1 cut(s) 227
FaeI CATG 1 cut(s) 215
FaiI YATR 9 cut(s) 63, 84, 143, 204, 213, 252, 312, 323, 344
FatI CATG 1 cut(s) 211
FspBI CTAG 2 cut(s) 117, 315
Hin1II CATG 1 cut(s) 215
HinfI GANTC 2 cut(s) 154, 280
HphI GGTGA 1 cut(s) 121
Hpy166II GTNNAC 1 cut(s) 352
Hpy188I TCNGA 2 cut(s) 185, 292
Hpy188III TCNNGA 2 cut(s) 239, 277
Hpy8I GTNNAC 1 cut(s) 352
HpyAV CCTTC 2 cut(s) 23, 297
HpyCH4IV ACGT 2 cut(s) 226, 340
HpyCH4V TGCA 2 cut(s) 325, 373
HpyF3I CTNAG 3 cut(s) 150, 291, 366
HpySE526I ACGT 2 cut(s) 226, 340
Hsp92II CATG 1 cut(s) 215
Kzo9I GATC 2 cut(s) 180, 307
LpnPI CCDG 4 cut(s) 8, 80, 118, 220
MaeI CTAG 2 cut(s) 117, 315
MaeII ACGT 2 cut(s) 226, 340
MaeIII GTNAC 1 cut(s) 127
MalI GATC 2 cut(s) 182, 309
MboI GATC 2 cut(s) 180, 307
MboII GAAGA 6 cut(s) 16, 110, 184, 187, 321, 324
MflI RGATCY 1 cut(s) 180
MluCI AATT 3 cut(s) 50, 244, 318
MnlI CCTC 3 cut(s) 142, 267, 294
MroXI GAANNNNTTC 1 cut(s) 246
MseI TTAA 2 cut(s) 18, 360
NdeII GATC 2 cut(s) 180, 307
NlaIII CATG 1 cut(s) 215
NlaIV GGNNCC 1 cut(s) 76
NmuCI GTSAC 1 cut(s) 127
PdmI GAANNNNTTC 1 cut(s) 246
PfeI GAWTC 2 cut(s) 154, 280
PmaCI CACGTG 1 cut(s) 227
PmlI CACGTG 1 cut(s) 227
Ppu21I YACGTR 2 cut(s) 227, 341
PspCI CACGTG 1 cut(s) 227
PspN4I GGNNCC 1 cut(s) 76
PsuI RGATCY 1 cut(s) 180
SaqAI TTAA 2 cut(s) 18, 360
Sau3AI GATC 2 cut(s) 180, 307
SetI ASST 7 cut(s) 27, 116, 122, 134, 209, 229, 343
SnaBI TACGTA 1 cut(s) 341
Sse9I AATT 3 cut(s) 50, 244, 318
SspMI CTAG 2 cut(s) 117, 315
TaiI ACGT 2 cut(s) 229, 343
TasI AATT 3 cut(s) 50, 244, 318
TfiI GAWTC 2 cut(s) 154, 280
Tru1I TTAA 2 cut(s) 18, 360
Tru9I TTAA 2 cut(s) 18, 360
TseFI GTSAC 1 cut(s) 127
Tsp45I GTSAC 1 cut(s) 127
TspDTI ATGAA 4 cut(s) 17, 99, 239, 262
XapI RAATTY 2 cut(s) 50, 244
XmnI GAANNNNTTC 1 cut(s) 246
XspI CTAG 2 cut(s) 117, 315
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.