Rmu_sc0022348.1_g000001

Zinc finger protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0022348.1
Physical Location & Seq
Reverse (-)
824 .. 1375
552 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0022348.1_g000001.1.cds

Sequence Viewer

Length: 552 bp
atgaagaagtgtgagctgtgtgattctatggcaaagatgtactgtgaatcagatcaggctagtctgtgttgggattgtgacatcaaggttcatggtgcaaacttcttggtggcgaagcatttaaggactctgctctgccatgtctgtcaatctctaaccccatggaatgcctctggacccaagcttggtcatactgtttcagtttgtgagaattgtgtgaacagttctaacaaggagtccacaaatgaagaagaagaagaacatgatgatgatgatcatgaagaaaatagcattggagaagatgatgaacatgatggtggtggtggcgacaatggcgctgatgataacgatggtggtgatgatgatgatgatgatgaggagaatcaagttgttccatggtcatccagctcttctactccaccggactcaagttctttaagtgatgaagaatgttgccatgaaagcttctcagaaacaagatcatcatatccatgtaagcgcaggcgctacaatgcactcttgaattctcaagcacgcaatttcttcacctaa

Protein Analysis

183

Amino Acids

20.28

Weight (kDa)

4.27

Isoelectric Point (pI)

62.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 523
AfaI GTAC 1 cut(s) 41
AfiI CCNNNNNNNGG 1 cut(s) 185
AgsI TTSAA 1 cut(s) 523
AjuI GAANNNNNNNTTGG 2 cut(s) 276, 308
AluBI AGCT 4 cut(s) 16, 184, 408, 465
AluI AGCT 4 cut(s) 16, 184, 408, 465
ApoI RAATTY 1 cut(s) 523
AspLEI GCGC 3 cut(s) 338, 501, 507
AspS9I GGNCC 1 cut(s) 176
AsuHPI GGTGA 2 cut(s) 368, 538
AvaII GGWCC 1 cut(s) 176
BccI CCATC 2 cut(s) 308, 344
BclI TGATCA 1 cut(s) 274
BfaI CTAG 1 cut(s) 60
BfoI RGCGCY 2 cut(s) 339, 508
Bme18I GGWCC 1 cut(s) 176
BmgT120I GGNCC 1 cut(s) 176
BmiI GGNNCC 1 cut(s) 178
BpuEI CTTGAG 2 cut(s) 412, 513
BsaBI GATNNNNATC 1 cut(s) 273
BsaJI CCNNGG 2 cut(s) 161, 395
BsaWI WCCGGW 1 cut(s) 421
Bsc4I CCNNNNNNNGG 1 cut(s) 185
Bse8I GATNNNNATC 1 cut(s) 273
BseDI CCNNGG 2 cut(s) 161, 395
BseGI GGATG 1 cut(s) 401
BseJI GATNNNNATC 1 cut(s) 273
BseLI CCNNNNNNNGG 1 cut(s) 185
BseMII CTCAG 1 cut(s) 483
BseRI GAGGAG 1 cut(s) 392
BsiSI CCGG 1 cut(s) 422
BslI CCNNNNNNNGG 1 cut(s) 185
BsmI GAATGC 1 cut(s) 172
Bsp143I GATC 3 cut(s) 52, 274, 479
Bsp19I CCATGG 2 cut(s) 161, 395
BspCNI CTCAG 1 cut(s) 482
BspHI TCATGA 1 cut(s) 277
BspLI GGNNCC 1 cut(s) 178
BspQI GCTCTTC 1 cut(s) 415
BssECI CCNNGG 2 cut(s) 161, 395
BssMI GATC 3 cut(s) 52, 274, 479
BssT1I CCWWGG 2 cut(s) 161, 395
Bst4CI ACNGT 3 cut(s) 44, 196, 224
Bst6I CTCTTC 1 cut(s) 415
BstC8I GCNNGC 2 cut(s) 503, 535
BstDEI CTNAG 1 cut(s) 469
BstDSI CCRYGG 2 cut(s) 161, 395
BstF5I GGATG 1 cut(s) 401
BstH2I RGCGCY 2 cut(s) 339, 508
BstHHI GCGC 3 cut(s) 338, 501, 507
BstKTI GATC 3 cut(s) 55, 277, 482
BstMBI GATC 3 cut(s) 52, 274, 479
BstMWI GCNNNNNNNGC 2 cut(s) 333, 462
BtgI CCRYGG 2 cut(s) 161, 395
BtsCI GGATG 1 cut(s) 401
Cac8I GCNNGC 2 cut(s) 503, 535
CciI TCATGA 1 cut(s) 277
CfoI GCGC 3 cut(s) 338, 501, 507
Cfr13I GGNCC 1 cut(s) 176
Csp6I GTAC 1 cut(s) 40
CviAII CATG 9 cut(s) 92, 140, 162, 263, 278, 311, 396, 458, 492
CviJI RGCY 5 cut(s) 16, 59, 184, 408, 465
CviKI_1 RGCY 5 cut(s) 16, 59, 184, 408, 465
CviQI GTAC 1 cut(s) 40
DdeI CTNAG 1 cut(s) 469
DpnI GATC 3 cut(s) 54, 276, 481
DpnII GATC 3 cut(s) 52, 274, 479
Eam1104I CTCTTC 1 cut(s) 415
EarI CTCTTC 1 cut(s) 415
Eco130I CCWWGG 2 cut(s) 161, 395
Eco47I GGWCC 1 cut(s) 176
EcoRI GAATTC 1 cut(s) 523
EcoT14I CCWWGG 2 cut(s) 161, 395
ErhI CCWWGG 2 cut(s) 161, 395
FaeI CATG 9 cut(s) 95, 143, 165, 266, 281, 314, 399, 461, 495
FatI CATG 9 cut(s) 91, 139, 161, 262, 277, 310, 395, 457, 491
FbaI TGATCA 1 cut(s) 274
FokI GGATG 1 cut(s) 388
FspBI CTAG 1 cut(s) 60
GlaI GCGC 3 cut(s) 337, 500, 506
HaeII RGCGCY 2 cut(s) 339, 508
HapII CCGG 1 cut(s) 422
HhaI GCGC 3 cut(s) 338, 501, 507
Hin1II CATG 9 cut(s) 95, 143, 165, 266, 281, 314, 399, 461, 495
Hin6I GCGC 3 cut(s) 336, 499, 505
HinP1I GCGC 3 cut(s) 336, 499, 505
HindIII AAGCTT 2 cut(s) 182, 463
HinfI GANTC 6 cut(s) 23, 47, 127, 236, 382, 425
HpaII CCGG 1 cut(s) 422
HphI GGTGA 2 cut(s) 368, 538
Hpy166II GTNNAC 2 cut(s) 220, 240
Hpy188I TCNGA 2 cut(s) 52, 472
Hpy188III TCNNGA 3 cut(s) 174, 278, 520
Hpy8I GTNNAC 2 cut(s) 220, 240
HpyCH4III ACNGT 3 cut(s) 44, 196, 224
HpyCH4V TGCA 2 cut(s) 98, 515
HpyF10VI GCNNNNNNNGC 2 cut(s) 333, 462
HpyF3I CTNAG 1 cut(s) 469
Hsp92II CATG 9 cut(s) 95, 143, 165, 266, 281, 314, 399, 461, 495
HspAI GCGC 3 cut(s) 336, 499, 505
Ksp22I TGATCA 1 cut(s) 274
Kzo9I GATC 3 cut(s) 52, 274, 479
LguI GCTCTTC 1 cut(s) 415
LpnPI CCDG 5 cut(s) 41, 159, 418, 435, 487
MaeI CTAG 1 cut(s) 60
MaeIII GTNAC 1 cut(s) 77
MalI GATC 3 cut(s) 54, 276, 481
MboI GATC 3 cut(s) 52, 274, 479
MluCI AATT 3 cut(s) 211, 523, 538
MlyI GAGTC 3 cut(s) 121, 245, 419
MnlI CCTC 2 cut(s) 181, 370
MseI TTAA 2 cut(s) 122, 437
MslI CAYNNNNRTG 3 cut(s) 267, 315, 490
MspI CCGG 1 cut(s) 422
Mva1269I GAATGC 1 cut(s) 172
MwoI GCNNNNNNNGC 2 cut(s) 333, 462
NcoI CCATGG 2 cut(s) 161, 395
NdeII GATC 3 cut(s) 52, 274, 479
NlaIII CATG 9 cut(s) 95, 143, 165, 266, 281, 314, 399, 461, 495
NlaIV GGNNCC 1 cut(s) 178
NmuCI GTSAC 1 cut(s) 77
PagI TCATGA 1 cut(s) 277
PciSI GCTCTTC 1 cut(s) 415
PctI GAATGC 1 cut(s) 172
PfeI GAWTC 3 cut(s) 23, 47, 382
PleI GAGTC 3 cut(s) 121, 244, 419
PpsI GAGTC 3 cut(s) 121, 244, 419
PspN4I GGNNCC 1 cut(s) 178
PspPI GGNCC 1 cut(s) 176
RsaI GTAC 1 cut(s) 41
RsaNI GTAC 1 cut(s) 40
RseI CAYNNNNRTG 3 cut(s) 267, 315, 490
SapI GCTCTTC 1 cut(s) 415
SaqAI TTAA 2 cut(s) 122, 437
Sau3AI GATC 3 cut(s) 52, 274, 479
Sau96I GGNCC 1 cut(s) 176
SchI GAGTC 3 cut(s) 121, 245, 419
SetI ASST 6 cut(s) 18, 90, 186, 410, 467, 551
SinI GGWCC 1 cut(s) 176
SmiMI CAYNNNNRTG 3 cut(s) 267, 315, 490
SmlI CTYRAG 2 cut(s) 427, 528
SmoI CTYRAG 2 cut(s) 427, 528
Sse9I AATT 3 cut(s) 211, 523, 538
SspMI CTAG 1 cut(s) 60
StyI CCWWGG 2 cut(s) 161, 395
TaaI ACNGT 3 cut(s) 44, 196, 224
TasI AATT 3 cut(s) 211, 523, 538
TatI WGTACW 1 cut(s) 39
TfiI GAWTC 3 cut(s) 23, 47, 382
Tru1I TTAA 2 cut(s) 122, 437
Tru9I TTAA 2 cut(s) 122, 437
TseFI GTSAC 1 cut(s) 77
Tsp45I GTSAC 1 cut(s) 77
TspDTI ATGAA 7 cut(s) 17, 80, 261, 294, 321, 459, 474
VpaK11BI GGWCC 1 cut(s) 176
XapI RAATTY 1 cut(s) 523
XspI CTAG 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.