Rroxscaffold_2G00121400

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0001674
Physical Location & Seq
Reverse (-)
54010613 .. 54013725
3113 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00121400.1

Sequence Viewer

Length: 273 bp
ATGCTTGAACCGATCTTGCTTAAGGAAACTAGTGCATTTGTGATGAACAGACCGAAGAAGTTTGATCAAGACAAAGAAGAGATGCCTGATCATCACATGTATATGATTCATGATCAAAATAAACAAGAGAACGCCGGCATGTATATTCTTCACAAGAATCCACCGTACATGATTGTATATGAAGAGAGTCTCGGTGAGAGCACGCTTGGAAAGGAAGAAAAGCATTTCTTGGTGGAGCTTGAAAGAAAAAGCAGAGTTGTCAATAAGCAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

10.76

Weight (kDa)

5.93

Isoelectric Point (pI)

69.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 167
AflII CTTAAG 1 cut(s) 20
AflIII ACRYGT 1 cut(s) 96
AgsI TTSAA 2 cut(s) 8, 242
AhlI ACTAGT 1 cut(s) 29
AluBI AGCT 1 cut(s) 238
AluI AGCT 1 cut(s) 238
Alw21I GWGCWC 1 cut(s) 203
Alw26I GTCTC 1 cut(s) 194
AsuHPI GGTGA 1 cut(s) 206
Bbv12I GWGCWC 1 cut(s) 203
BclI TGATCA 3 cut(s) 64, 88, 112
BcoDI GTCTC 1 cut(s) 194
BcuI ACTAGT 1 cut(s) 29
BfaI CTAG 1 cut(s) 30
BfrI CTTAAG 1 cut(s) 20
BmsI GCATC 1 cut(s) 72
Bse118I RCCGGY 1 cut(s) 134
BsiHKAI GWGCWC 1 cut(s) 203
BsiSI CCGG 1 cut(s) 135
BsmAI GTCTC 1 cut(s) 194
Bsp1286I GDGCHC 1 cut(s) 203
Bsp143I GATC 4 cut(s) 12, 64, 88, 112
BspHI TCATGA 1 cut(s) 109
BspTI CTTAAG 1 cut(s) 20
BsrFI RCCGGY 1 cut(s) 134
BssAI RCCGGY 1 cut(s) 134
BssMI GATC 4 cut(s) 12, 64, 88, 112
Bst4CI ACNGT 1 cut(s) 165
Bst6I CTCTTC 2 cut(s) 72, 177
BstAFI CTTAAG 1 cut(s) 20
BstC8I GCNNGC 2 cut(s) 136, 203
BstKTI GATC 4 cut(s) 15, 67, 91, 115
BstMAI GTCTC 1 cut(s) 194
BstMBI GATC 4 cut(s) 12, 64, 88, 112
BstNSI RCATGY 2 cut(s) 100, 142
Cac8I GCNNGC 2 cut(s) 136, 203
CciI TCATGA 1 cut(s) 109
Cfr10I RCCGGY 1 cut(s) 134
Csp6I GTAC 1 cut(s) 166
CviAII CATG 4 cut(s) 97, 110, 139, 169
CviJI RGCY 1 cut(s) 238
CviKI_1 RGCY 1 cut(s) 238
CviQI GTAC 1 cut(s) 166
DpnI GATC 4 cut(s) 14, 66, 90, 114
DpnII GATC 4 cut(s) 12, 64, 88, 112
Eam1104I CTCTTC 2 cut(s) 72, 177
EarI CTCTTC 2 cut(s) 72, 177
FaeI CATG 4 cut(s) 100, 113, 142, 172
FaiI YATR 9 cut(s) 98, 102, 104, 111, 140, 144, 170, 178, 180
FalI AAGNNNNNCTT 2 cut(s) 212, 244
FatI CATG 4 cut(s) 96, 109, 138, 168
FbaI TGATCA 3 cut(s) 64, 88, 112
FspBI CTAG 1 cut(s) 30
HapII CCGG 1 cut(s) 135
Hin1II CATG 4 cut(s) 100, 113, 142, 172
HinfI GANTC 3 cut(s) 106, 157, 187
HpaII CCGG 1 cut(s) 135
HphI GGTGA 1 cut(s) 206
Hpy188III TCNNGA 2 cut(s) 68, 110
HpyCH4III ACNGT 1 cut(s) 165
HpyCH4V TGCA 1 cut(s) 35
Hsp92II CATG 4 cut(s) 100, 113, 142, 172
KroI GCCGGC 1 cut(s) 134
KroNI GCCGGC 1 cut(s) 136
Ksp22I TGATCA 3 cut(s) 64, 88, 112
Kzo9I GATC 4 cut(s) 12, 64, 88, 112
LmnI GCTCC 1 cut(s) 235
LpnPI CCDG 2 cut(s) 99, 148
LweI GCATC 1 cut(s) 72
MaeI CTAG 1 cut(s) 30
MalI GATC 4 cut(s) 14, 66, 90, 114
MboI GATC 4 cut(s) 12, 64, 88, 112
MboII GAAGA 5 cut(s) 67, 89, 140, 194, 227
MhlI GDGCHC 1 cut(s) 203
MlyI GAGTC 1 cut(s) 196
MroNI GCCGGC 1 cut(s) 134
MseI TTAA 1 cut(s) 21
MslI CAYNNNNRTG 1 cut(s) 101
MspCI CTTAAG 1 cut(s) 20
MspI CCGG 1 cut(s) 135
NaeI GCCGGC 1 cut(s) 136
NdeII GATC 4 cut(s) 12, 64, 88, 112
NgoMIV GCCGGC 1 cut(s) 134
NlaIII CATG 4 cut(s) 100, 113, 142, 172
NspI RCATGY 2 cut(s) 100, 142
PagI TCATGA 1 cut(s) 109
PciI ACATGT 1 cut(s) 96
PdiI GCCGGC 1 cut(s) 136
PfeI GAWTC 2 cut(s) 106, 157
PleI GAGTC 1 cut(s) 195
PpsI GAGTC 1 cut(s) 195
PscI ACATGT 1 cut(s) 96
RsaI GTAC 1 cut(s) 167
RsaNI GTAC 1 cut(s) 166
RseI CAYNNNNRTG 1 cut(s) 101
SaqAI TTAA 1 cut(s) 21
Sau3AI GATC 4 cut(s) 12, 64, 88, 112
SchI GAGTC 1 cut(s) 196
SduI GDGCHC 1 cut(s) 203
SetI ASST 1 cut(s) 240
SfaNI GCATC 1 cut(s) 72
SmiMI CAYNNNNRTG 1 cut(s) 101
SmlI CTYRAG 1 cut(s) 20
SmoI CTYRAG 1 cut(s) 20
SpeI ACTAGT 1 cut(s) 29
SspMI CTAG 1 cut(s) 30
TaaI ACNGT 1 cut(s) 165
TaqII GACCGA 1 cut(s) 67
TfiI GAWTC 2 cut(s) 106, 157
Tru1I TTAA 1 cut(s) 21
Tru9I TTAA 1 cut(s) 21
TspDTI ATGAA 3 cut(s) 59, 98, 195
Vha464I CTTAAG 1 cut(s) 20
XceI RCATGY 2 cut(s) 100, 142
XspI CTAG 1 cut(s) 30
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.