Rh2DG017100

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
OG0001674
Physical Location & Seq
Forward (+)
977762 .. 978164
403 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG017100.1

Sequence Viewer

Length: 228 bp
ATGGAAACTTGTGCAGTTGTGATGAACAGGTCGAAGAAGAGTGGCCTACTGGTTTCACAGCAGGGGAGTAACATCCGGAGCAACGATCTAGAGGACATATACATGATTCACCATCATACTCAAAAAGAGAACCTGAAAGTGTACATTGTTGAGACTGATCCACCAGATATGATTTTAAATTTTGTCTATGAAATATTAAATGACTGCAACTGCATCGAGGATGTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

8.66

Weight (kDa)

4.73

Isoelectric Point (pI)

49.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 75
AclWI GGATC 1 cut(s) 152
AcsI RAATTY 1 cut(s) 178
AfaI GTAC 1 cut(s) 143
Alw26I GTCTC 1 cut(s) 146
AlwI GGATC 1 cut(s) 152
Aor13HI TCCGGA 1 cut(s) 75
AoxI GGCC 1 cut(s) 43
ApoI RAATTY 1 cut(s) 178
AsuHPI GGTGA 1 cut(s) 101
BccI CCATC 1 cut(s) 120
BcgI CGANNNNNNTGC 1 cut(s) 196
BcoDI GTCTC 1 cut(s) 146
BfaI CTAG 1 cut(s) 89
BmsI GCATC 1 cut(s) 222
BsaWI WCCGGW 1 cut(s) 75
Bse1I ACTGG 1 cut(s) 54
BseAI TCCGGA 1 cut(s) 75
BseGI GGATG 2 cut(s) 72, 226
BseNI ACTGG 1 cut(s) 54
BsgI GTGCAG 1 cut(s) 33
BshFI GGCC 1 cut(s) 45
BsiSI CCGG 1 cut(s) 76
BsmAI GTCTC 1 cut(s) 146
BsnI GGCC 1 cut(s) 45
Bsp13I TCCGGA 1 cut(s) 75
Bsp1407I TGTACA 1 cut(s) 141
Bsp143I GATC 2 cut(s) 85, 157
BspANI GGCC 1 cut(s) 45
BspEI TCCGGA 1 cut(s) 75
BspPI GGATC 1 cut(s) 152
BsrGI TGTACA 1 cut(s) 141
BsrI ACTGG 1 cut(s) 54
BssMI GATC 2 cut(s) 85, 157
Bst6I CTCTTC 1 cut(s) 32
BstAUI TGTACA 1 cut(s) 141
BstF5I GGATG 2 cut(s) 72, 226
BstKTI GATC 2 cut(s) 88, 160
BstMAI GTCTC 1 cut(s) 146
BstMBI GATC 2 cut(s) 85, 157
BsuRI GGCC 1 cut(s) 45
BtsCI GGATG 2 cut(s) 72, 226
Csp6I GTAC 1 cut(s) 142
CviAII CATG 1 cut(s) 103
CviJI RGCY 1 cut(s) 45
CviKI_1 RGCY 1 cut(s) 45
CviQI GTAC 1 cut(s) 142
DpnI GATC 2 cut(s) 87, 159
DpnII GATC 2 cut(s) 85, 157
DraI TTTAAA 1 cut(s) 177
Eam1104I CTCTTC 1 cut(s) 32
EarI CTCTTC 1 cut(s) 32
FaeI CATG 1 cut(s) 106
FaiI YATR 6 cut(s) 98, 100, 104, 117, 170, 189
FatI CATG 1 cut(s) 102
FokI GGATG 1 cut(s) 59
FspBI CTAG 1 cut(s) 89
HaeIII GGCC 1 cut(s) 45
HapII CCGG 1 cut(s) 76
Hin1II CATG 1 cut(s) 106
HinfI GANTC 1 cut(s) 106
HpaII CCGG 1 cut(s) 76
HphI GGTGA 1 cut(s) 101
Hpy166II GTNNAC 1 cut(s) 142
Hpy188I TCNGA 1 cut(s) 227
Hpy188III TCNNGA 2 cut(s) 76, 89
Hpy8I GTNNAC 1 cut(s) 142
HpyCH4V TGCA 3 cut(s) 14, 207, 213
Hsp92II CATG 1 cut(s) 106
Kpn2I TCCGGA 1 cut(s) 75
Kzo9I GATC 2 cut(s) 85, 157
LmnI GCTCC 1 cut(s) 78
LpnPI CCDG 6 cut(s) 13, 35, 47, 89, 146, 177
LweI GCATC 1 cut(s) 222
MaeI CTAG 1 cut(s) 89
MaeIII GTNAC 1 cut(s) 68
MalI GATC 2 cut(s) 87, 159
MboI GATC 2 cut(s) 85, 157
MboII GAAGA 2 cut(s) 46, 49
MluCI AATT 1 cut(s) 178
MnlI CCTC 2 cut(s) 85, 211
MroI TCCGGA 1 cut(s) 75
MseI TTAA 2 cut(s) 176, 197
MslI CAYNNNNRTG 1 cut(s) 101
MspI CCGG 1 cut(s) 76
NdeII GATC 2 cut(s) 85, 157
NlaIII CATG 1 cut(s) 106
PfeI GAWTC 1 cut(s) 106
RsaI GTAC 1 cut(s) 143
RsaNI GTAC 1 cut(s) 142
RseI CAYNNNNRTG 1 cut(s) 101
SaqAI TTAA 2 cut(s) 176, 197
Sau3AI GATC 2 cut(s) 85, 157
SetI ASST 2 cut(s) 32, 135
SfaNI GCATC 1 cut(s) 222
SgeI CNNG 9 cut(s) 21, 40, 62, 74, 88, 101, 115, 145, 176
SmiMI CAYNNNNRTG 1 cut(s) 101
Sse9I AATT 1 cut(s) 178
SspI AATATT 1 cut(s) 195
SspMI CTAG 1 cut(s) 89
TaqI TCGA 2 cut(s) 32, 216
TasI AATT 1 cut(s) 178
TatI WGTACW 1 cut(s) 141
TfiI GAWTC 1 cut(s) 106
Tru1I TTAA 2 cut(s) 176, 197
Tru9I TTAA 2 cut(s) 176, 197
TspDTI ATGAA 2 cut(s) 38, 204
XapI RAATTY 1 cut(s) 178
XbaI TCTAGA 1 cut(s) 88
XspI CTAG 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.