Rh2AG015200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Forward (+)
1163922 .. 1165365
1444 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG015200.1

Sequence Viewer

Length: 285 bp
ATGAGAGAATACAGCAACACTGATTCCTGGACTAGATCCTTCAGCCTAAGGTTTTCTGATGAGCCCGATAAGCGGATTTACATGCTTGAACCGATATTGCTCAAGGAAACTTGTGCATTTGTGATGAACAGACCGAAGAAGTTTGATCAAGACAGAGAAGAGATGCCTGATCACATGAAACATTATGATTATGATTTGAATAGGAGCACGCTTGGAAAGGAAGAAAAGCTCAGCTTGAAAGAAAGAGCAAAGTTGTACGTCAATAAGCATGCAAAAGGTTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

94

Amino Acids

11.39

Weight (kDa)

8.67

Isoelectric Point (pI)

54.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 73
AclWI GGATC 1 cut(s) 30
AcuI CTGAAG 1 cut(s) 25
AfaI GTAC 1 cut(s) 257
AfiI CCNNNNNNNGG 1 cut(s) 72
AgsI TTSAA 3 cut(s) 89, 199, 238
AjnI CCWGG 1 cut(s) 26
AluBI AGCT 2 cut(s) 229, 234
AluI AGCT 2 cut(s) 229, 234
Alw21I GWGCWC 1 cut(s) 209
AlwI GGATC 1 cut(s) 30
AxyI CCTNAGG 1 cut(s) 47
BanII GRGCYC 1 cut(s) 66
Bbv12I GWGCWC 1 cut(s) 209
BciT130I CCWGG 1 cut(s) 28
BclI TGATCA 2 cut(s) 145, 169
BfaI CTAG 1 cut(s) 33
BlpI GCTNAGC 1 cut(s) 230
Bme1390I CCNGG 1 cut(s) 28
BmrFI CCNGG 1 cut(s) 28
BmsI GCATC 1 cut(s) 153
Bpu1102I GCTNAGC 1 cut(s) 230
BpuEI CTTGAG 1 cut(s) 86
Bsc4I CCNNNNNNNGG 1 cut(s) 72
Bse21I CCTNAGG 1 cut(s) 47
BseBI CCWGG 1 cut(s) 28
BseLI CCNNNNNNNGG 1 cut(s) 72
BseMII CTCAG 1 cut(s) 244
BsiHKAI GWGCWC 1 cut(s) 209
BslI CCNNNNNNNGG 1 cut(s) 72
Bsp1286I GDGCHC 2 cut(s) 66, 209
Bsp143I GATC 3 cut(s) 35, 145, 169
Bsp1720I GCTNAGC 1 cut(s) 230
BspACI CCGC 1 cut(s) 73
BspCNI CTCAG 1 cut(s) 243
BspPI GGATC 1 cut(s) 30
BssMI GATC 3 cut(s) 35, 145, 169
Bst2UI CCWGG 1 cut(s) 28
Bst6I CTCTTC 1 cut(s) 153
BstC8I GCNNGC 2 cut(s) 209, 270
BstDEI CTNAG 2 cut(s) 47, 230
BstKTI GATC 3 cut(s) 38, 148, 172
BstMBI GATC 3 cut(s) 35, 145, 169
BstMWI GCNNNNNNNGC 1 cut(s) 70
BstNI CCWGG 1 cut(s) 28
BstNSI RCATGY 2 cut(s) 85, 272
BstSCI CCNGG 1 cut(s) 26
BstX2I RGATCY 1 cut(s) 35
BstYI RGATCY 1 cut(s) 35
Bsu36I CCTNAGG 1 cut(s) 47
BtsIMutI CAGTG 1 cut(s) 18
Cac8I GCNNGC 2 cut(s) 209, 270
Csp6I GTAC 1 cut(s) 256
CviAII CATG 3 cut(s) 82, 175, 269
CviJI RGCY 4 cut(s) 45, 64, 229, 234
CviKI_1 RGCY 4 cut(s) 45, 64, 229, 234
CviQI GTAC 1 cut(s) 256
DdeI CTNAG 2 cut(s) 47, 230
DpnI GATC 3 cut(s) 37, 147, 171
DpnII GATC 3 cut(s) 35, 145, 169
Eam1104I CTCTTC 1 cut(s) 153
EarI CTCTTC 1 cut(s) 153
Eco24I GRGCYC 1 cut(s) 66
Eco57I CTGAAG 1 cut(s) 25
Eco81I CCTNAGG 1 cut(s) 47
EcoRII CCWGG 1 cut(s) 26
EcoT38I GRGCYC 1 cut(s) 66
FaeI CATG 3 cut(s) 85, 178, 272
FaiI YATR 5 cut(s) 83, 176, 186, 192, 270
FalI AAGNNNNNCTT 2 cut(s) 218, 250
FatI CATG 3 cut(s) 81, 174, 268
FbaI TGATCA 2 cut(s) 145, 169
FriOI GRGCYC 1 cut(s) 66
FspBI CTAG 1 cut(s) 33
Hin1II CATG 3 cut(s) 85, 178, 272
HinfI GANTC 1 cut(s) 23
Hpy188I TCNGA 1 cut(s) 58
Hpy188III TCNNGA 1 cut(s) 149
HpyAV CCTTC 1 cut(s) 49
HpyCH4IV ACGT 1 cut(s) 258
HpyCH4V TGCA 2 cut(s) 116, 272
HpyF10VI GCNNNNNNNGC 1 cut(s) 70
HpyF3I CTNAG 2 cut(s) 47, 230
HpySE526I ACGT 1 cut(s) 258
Hsp92II CATG 3 cut(s) 85, 178, 272
Ksp22I TGATCA 2 cut(s) 145, 169
Kzo9I GATC 3 cut(s) 35, 145, 169
LmnI GCTCC 1 cut(s) 204
LpnPI CCDG 3 cut(s) 13, 40, 180
LweI GCATC 1 cut(s) 153
MaeI CTAG 1 cut(s) 33
MaeII ACGT 1 cut(s) 258
MalI GATC 3 cut(s) 37, 147, 171
MboI GATC 3 cut(s) 35, 145, 169
MboII GAAGA 3 cut(s) 148, 170, 233
MflI RGATCY 1 cut(s) 35
MhlI GDGCHC 2 cut(s) 66, 209
MspR9I CCNGG 1 cut(s) 28
MvaI CCWGG 1 cut(s) 28
MwoI GCNNNNNNNGC 1 cut(s) 70
NdeII GATC 3 cut(s) 35, 145, 169
NlaIII CATG 3 cut(s) 85, 178, 272
NspI RCATGY 2 cut(s) 85, 272
PaeI GCATGC 1 cut(s) 272
PfeI GAWTC 1 cut(s) 23
PfoI TCCNGGA 1 cut(s) 26
Psp6I CCWGG 1 cut(s) 26
PspGI CCWGG 1 cut(s) 26
PsuI RGATCY 1 cut(s) 35
RsaI GTAC 1 cut(s) 257
RsaNI GTAC 1 cut(s) 256
Sau3AI GATC 3 cut(s) 35, 145, 169
ScrFI CCNGG 1 cut(s) 28
SduI GDGCHC 2 cut(s) 66, 209
SetI ASST 5 cut(s) 53, 231, 236, 261, 280
SfaNI GCATC 1 cut(s) 153
SmlI CTYRAG 1 cut(s) 101
SmoI CTYRAG 1 cut(s) 101
SphI GCATGC 1 cut(s) 272
SsiI CCGC 1 cut(s) 73
SspMI CTAG 1 cut(s) 33
StyD4I CCNGG 1 cut(s) 26
TaiI ACGT 1 cut(s) 261
TaqII GACCGA 1 cut(s) 148
TfiI GAWTC 1 cut(s) 23
TscAI CASTG 1 cut(s) 25
TspDTI ATGAA 2 cut(s) 140, 191
TspRI CASTG 1 cut(s) 25
XceI RCATGY 2 cut(s) 85, 272
XspI CTAG 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.