Rroxscaffold_2G00138980

Subtilase family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
77224436 .. 77227729
3294 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00138980.1

Sequence Viewer

Length: 402 bp
ATGGAAGGGGGTTTGTCAATCGGGAGAGGCATTCAATGCTTCAACTTGCAACAGATATACTATAAGTCCGGTTATGAAGCCGAGGAAGATTCAGCGGACACGGTGGCATTCAGTTCTCCAAGGACGGTGCGGTCATGGCAGCCACACGCCTCTATAGCTGCTGGTCGTTATGTGTCAAACATGACTTATAAGGGCTGCAGCCACCTTTGCTCAAGGCATGGCTTCGAGGATGGAAAAGATATCCGTCTAGGGGACCGGAAAGCTGCTGATGTCGAGATCCCGAATACCTTTCAATTGCTAACAGCTAAGCTCGTTGTTTACTTGGCGGCTTTCAAAGGCTCCTCAAGCTGCAGGGGACCATCCATACTGATTTTGAGAGAGGATTCATTTGTGCTGAGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

133

Amino Acids

14.69

Weight (kDa)

8.38

Isoelectric Point (pI)

38.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 189
AasI GACNNNNNNGTC 1 cut(s) 130
AciI CCGC 3 cut(s) 95, 130, 326
AclWI GGATC 1 cut(s) 271
AfiI CCNNNNNNNGG 1 cut(s) 250
AgsI TTSAA 4 cut(s) 35, 43, 293, 334
AluBI AGCT 5 cut(s) 158, 263, 305, 310, 348
AluI AGCT 5 cut(s) 158, 263, 305, 310, 348
AlwI GGATC 1 cut(s) 271
ApeKI GCWGC 6 cut(s) 139, 158, 195, 198, 263, 348
AspS9I GGNCC 2 cut(s) 253, 356
AvaII GGWCC 2 cut(s) 253, 356
BbvCI CCTCAGC 1 cut(s) 395
BbvI GCAGC 6 cut(s) 145, 151, 182, 210, 250, 335
BccI CCATC 2 cut(s) 224, 367
BfaI CTAG 1 cut(s) 248
BfmI CTRYAG 3 cut(s) 153, 196, 349
BisI GCNGC 7 cut(s) 140, 159, 196, 199, 264, 327, 349
BlpI GCTNAGC 1 cut(s) 306
BlsI GCNGC 7 cut(s) 141, 160, 197, 200, 265, 328, 350
Bme18I GGWCC 2 cut(s) 253, 356
BmgT120I GGNCC 2 cut(s) 253, 356
BmiI GGNNCC 3 cut(s) 254, 340, 357
Bpu10I CCTNAGC 1 cut(s) 395
Bpu1102I GCTNAGC 1 cut(s) 306
BpuEI CTTGAG 2 cut(s) 196, 328
BsaJI CCNNGG 2 cut(s) 81, 119
BsaWI WCCGGW 2 cut(s) 68, 255
Bsc4I CCNNNNNNNGG 1 cut(s) 250
BseDI CCNNGG 2 cut(s) 81, 119
BseGI GGATG 2 cut(s) 235, 359
BseLI CCNNNNNNNGG 1 cut(s) 250
BseMII CTCAG 1 cut(s) 386
BseRI GAGGAG 1 cut(s) 331
BseXI GCAGC 6 cut(s) 145, 151, 182, 210, 250, 335
BsiSI CCGG 2 cut(s) 69, 256
BslFI GGGAC 2 cut(s) 266, 369
BslI CCNNNNNNNGG 1 cut(s) 250
BsmFI GGGAC 2 cut(s) 266, 369
BsmI GAATGC 2 cut(s) 30, 107
Bsp143I GATC 1 cut(s) 276
Bsp1720I GCTNAGC 1 cut(s) 306
BspACI CCGC 3 cut(s) 95, 130, 326
BspCNI CTCAG 1 cut(s) 387
BspLI GGNNCC 3 cut(s) 254, 340, 357
BspMAI CTGCAG 2 cut(s) 200, 353
BspPI GGATC 1 cut(s) 271
BssECI CCNNGG 2 cut(s) 81, 119
BssMI GATC 1 cut(s) 276
BssT1I CCWWGG 1 cut(s) 119
Bst4CI ACNGT 2 cut(s) 103, 127
BstAPI GCANNNNNTGC 1 cut(s) 36
BstDEI CTNAG 2 cut(s) 306, 395
BstF5I GGATG 2 cut(s) 235, 359
BstKTI GATC 1 cut(s) 279
BstMBI GATC 1 cut(s) 276
BstMWI GCNNNNNNNGC 5 cut(s) 36, 136, 155, 207, 345
BstSFI CTRYAG 3 cut(s) 153, 196, 349
BstV1I GCAGC 6 cut(s) 145, 151, 182, 210, 250, 335
BstX2I RGATCY 1 cut(s) 276
BstYI RGATCY 1 cut(s) 276
BtsCI GGATG 2 cut(s) 235, 359
Cfr13I GGNCC 2 cut(s) 253, 356
CviAII CATG 3 cut(s) 135, 181, 218
DdeI CTNAG 2 cut(s) 306, 395
DpnI GATC 1 cut(s) 278
DpnII GATC 1 cut(s) 276
DrdI GACNNNNNNGTC 1 cut(s) 130
DseDI GACNNNNNNGTC 1 cut(s) 130
Eco130I CCWWGG 1 cut(s) 119
Eco32I GATATC 1 cut(s) 241
Eco47I GGWCC 2 cut(s) 253, 356
EcoRV GATATC 1 cut(s) 241
EcoT14I CCWWGG 1 cut(s) 119
ErhI CCWWGG 1 cut(s) 119
FaeI CATG 3 cut(s) 138, 184, 221
FaqI GGGAC 2 cut(s) 266, 369
FatI CATG 3 cut(s) 134, 180, 217
Fnu4HI GCNGC 7 cut(s) 140, 159, 196, 199, 264, 327, 349
FokI GGATG 2 cut(s) 242, 346
Fsp4HI GCNGC 7 cut(s) 140, 159, 196, 199, 264, 327, 349
FspBI CTAG 1 cut(s) 248
GluI GCNGC 7 cut(s) 140, 159, 196, 199, 264, 327, 349
HapII CCGG 2 cut(s) 69, 256
Hin1II CATG 3 cut(s) 138, 184, 221
HinfI GANTC 2 cut(s) 89, 383
HpaII CCGG 2 cut(s) 69, 256
Hpy166II GTNNAC 1 cut(s) 319
Hpy188III TCNNGA 3 cut(s) 22, 274, 280
Hpy8I GTNNAC 1 cut(s) 319
HpyCH4III ACNGT 2 cut(s) 103, 127
HpyCH4V TGCA 3 cut(s) 49, 198, 351
HpyF10VI GCNNNNNNNGC 5 cut(s) 36, 136, 155, 207, 345
HpyF3I CTNAG 2 cut(s) 306, 395
Hsp92II CATG 3 cut(s) 138, 184, 221
Kzo9I GATC 1 cut(s) 276
LmnI GCTCC 1 cut(s) 344
LpnPI CCDG 4 cut(s) 82, 147, 269, 337
Lsp1109I GCAGC 6 cut(s) 145, 151, 182, 210, 250, 335
MaeI CTAG 1 cut(s) 248
MalI GATC 1 cut(s) 278
MboI GATC 1 cut(s) 276
MboII GAAGA 1 cut(s) 98
MfeI CAATTG 1 cut(s) 293
MflI RGATCY 1 cut(s) 276
MluCI AATT 1 cut(s) 293
MnlI CCTC 7 cut(s) 20, 76, 160, 220, 352, 373, 390
MspA1I CMGCKG 1 cut(s) 95
MspI CCGG 2 cut(s) 69, 256
MunI CAATTG 1 cut(s) 293
Mva1269I GAATGC 2 cut(s) 30, 107
MwoI GCNNNNNNNGC 5 cut(s) 36, 136, 155, 207, 345
NdeII GATC 1 cut(s) 276
NlaIII CATG 3 cut(s) 138, 184, 221
NlaIV GGNNCC 3 cut(s) 254, 340, 357
NmeAIII GCCGAG 1 cut(s) 106
PctI GAATGC 2 cut(s) 30, 107
PfeI GAWTC 2 cut(s) 89, 383
PkrI GCNGC 7 cut(s) 141, 160, 197, 200, 265, 328, 350
PsiI TTATAA 1 cut(s) 189
PspN4I GGNNCC 3 cut(s) 254, 340, 357
PspPI GGNCC 2 cut(s) 253, 356
PstI CTGCAG 2 cut(s) 200, 353
PsuI RGATCY 1 cut(s) 276
SatI GCNGC 7 cut(s) 140, 159, 196, 199, 264, 327, 349
Sau3AI GATC 1 cut(s) 276
Sau96I GGNCC 2 cut(s) 253, 356
SetI ASST 8 cut(s) 160, 207, 265, 290, 307, 312, 350, 401
SfcI CTRYAG 3 cut(s) 153, 196, 349
SinI GGWCC 2 cut(s) 253, 356
SmlI CTYRAG 2 cut(s) 211, 343
SmoI CTYRAG 2 cut(s) 211, 343
Sse9I AATT 1 cut(s) 293
SsiI CCGC 3 cut(s) 95, 130, 326
SspMI CTAG 1 cut(s) 248
StyI CCWWGG 1 cut(s) 119
TaaI ACNGT 2 cut(s) 103, 127
TaqI TCGA 2 cut(s) 225, 273
TasI AATT 1 cut(s) 293
TauI GCSGC 1 cut(s) 329
TfiI GAWTC 2 cut(s) 89, 383
TseI GCWGC 6 cut(s) 139, 158, 195, 198, 263, 348
TspDTI ATGAA 2 cut(s) 90, 375
TspGWI ACGGA 1 cut(s) 233
VpaK11BI GGWCC 2 cut(s) 253, 356
XspI CTAG 1 cut(s) 248
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.