Rh6AG215300

photo-lyase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Forward (+)
38509023 .. 38523511
14489 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG215300.1

Sequence Viewer

Length: 153 bp
ATGGACCATGCTTCGGATAAGCGAGAACATATTTACACGAGGGAGCAATTGGAGAAGGCACAAACTGCTGATCCTACTTGGGTGACTGTAAATTCTGCAAATGTGTCAGAACAGTTATATAAATATTCTTATTTAGATACAAAGTCCGTATGA

Protein Analysis

50

Amino Acids

5.85

Weight (kDa)

5.47

Isoelectric Point (pI)

20.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 65
AcsI RAATTY 1 cut(s) 91
AfiI CCNNNNNNNGG 1 cut(s) 13
AlwI GGATC 1 cut(s) 65
ApoI RAATTY 1 cut(s) 91
AspS9I GGNCC 1 cut(s) 4
AsuHPI GGTGA 1 cut(s) 94
AvaII GGWCC 1 cut(s) 4
BauI CACGAG 1 cut(s) 37
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 4
Bsc4I CCNNNNNNNGG 1 cut(s) 13
BseLI CCNNNNNNNGG 1 cut(s) 13
BslI CCNNNNNNNGG 1 cut(s) 13
Bsp143I GATC 1 cut(s) 70
BspPI GGATC 1 cut(s) 65
BssMI GATC 1 cut(s) 70
BssSI CACGAG 1 cut(s) 37
Bst2BI CACGAG 1 cut(s) 37
Bst4CI ACNGT 2 cut(s) 88, 114
BstAPI GCANNNNNTGC 1 cut(s) 65
BstKTI GATC 1 cut(s) 73
BstMBI GATC 1 cut(s) 70
BstMWI GCNNNNNNNGC 1 cut(s) 65
Cfr13I GGNCC 1 cut(s) 4
CviAII CATG 1 cut(s) 8
DpnI GATC 1 cut(s) 72
DpnII GATC 1 cut(s) 70
Eco47I GGWCC 1 cut(s) 4
FaeI CATG 1 cut(s) 11
FaiI YATR 5 cut(s) 9, 30, 118, 120, 151
FatI CATG 1 cut(s) 7
FspEI CC 8 cut(s) 20, 25, 26, 35, 41, 64, 65, 87
Hin1II CATG 1 cut(s) 11
HphI GGTGA 1 cut(s) 94
Hpy188I TCNGA 2 cut(s) 16, 109
HpyAV CCTTC 1 cut(s) 49
HpyCH4III ACNGT 2 cut(s) 88, 114
HpyCH4V TGCA 1 cut(s) 98
HpyF10VI GCNNNNNNNGC 1 cut(s) 65
Hsp92II CATG 1 cut(s) 11
Kzo9I GATC 1 cut(s) 70
LmnI GCTCC 1 cut(s) 43
MaeIII GTNAC 1 cut(s) 82
MalI GATC 1 cut(s) 72
MboI GATC 1 cut(s) 70
MfeI CAATTG 1 cut(s) 47
MluCI AATT 2 cut(s) 47, 91
MnlI CCTC 1 cut(s) 33
MunI CAATTG 1 cut(s) 47
MwoI GCNNNNNNNGC 1 cut(s) 65
NdeII GATC 1 cut(s) 70
NlaIII CATG 1 cut(s) 11
NmuCI GTSAC 1 cut(s) 82
PspPI GGNCC 1 cut(s) 4
Sau3AI GATC 1 cut(s) 70
Sau96I GGNCC 1 cut(s) 4
SgeI CNNG 5 cut(s) 20, 35, 49, 51, 90
SinI GGWCC 1 cut(s) 4
Sse9I AATT 2 cut(s) 47, 91
SspI AATATT 1 cut(s) 125
TaaI ACNGT 2 cut(s) 88, 114
TasI AATT 2 cut(s) 47, 91
TseFI GTSAC 1 cut(s) 82
Tsp45I GTSAC 1 cut(s) 82
TspGWI ACGGA 1 cut(s) 136
VpaK11BI GGWCC 1 cut(s) 4
XapI RAATTY 1 cut(s) 91
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.