Rroxscaffold_7G00166270

Cinnamoyl-CoA reductase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0001551
Physical Location & Seq
Reverse (-)
7798768 .. 7801110
2343 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00166270.1

Sequence Viewer

Length: 171 bp
ATGGGTCTCAAAGGTGGGTTTGGGTCGTTTGGATACAATTATTGGACCTTGGTGGATGTTCGTGACTTAGTCGAAGCACTCGCTTATGGTTTACAAGAAATCGACGCCGGAGAAAGATATATATGCACATCACATGCAATTGGGAGGTTGTTTACGGCCCTGTATGCGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Epimerase

Protein Analysis

56

Amino Acids

6.19

Weight (kDa)

4.95

Isoelectric Point (pI)

18.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcyI GRCGYC 1 cut(s) 105
Alw26I GTCTC 1 cut(s) 11
AoxI GGCC 1 cut(s) 156
AspS9I GGNCC 2 cut(s) 45, 157
AvaII GGWCC 1 cut(s) 45
BciVI GTATCC 1 cut(s) 26
BcoDI GTCTC 1 cut(s) 11
BfuI GTATCC 1 cut(s) 26
Bme18I GGWCC 1 cut(s) 45
BmgT120I GGNCC 2 cut(s) 45, 157
BsaHI GRCGYC 1 cut(s) 105
BsaI GGTCTC 1 cut(s) 11
BsaJI CCNNGG 1 cut(s) 48
BseDI CCNNGG 1 cut(s) 48
BseGI GGATG 1 cut(s) 61
BshFI GGCC 1 cut(s) 158
BsiSI CCGG 1 cut(s) 108
BsmAI GTCTC 1 cut(s) 11
BsnI GGCC 1 cut(s) 158
Bso31I GGTCTC 1 cut(s) 11
BspANI GGCC 1 cut(s) 158
BspTNI GGTCTC 1 cut(s) 11
BssECI CCNNGG 1 cut(s) 48
BssNI GRCGYC 1 cut(s) 105
BssT1I CCWWGG 1 cut(s) 48
BstACI GRCGYC 1 cut(s) 105
BstDEI CTNAG 1 cut(s) 67
BstF5I GGATG 1 cut(s) 61
BstMAI GTCTC 1 cut(s) 11
BstMWI GCNNNNNNNGC 1 cut(s) 164
BstNSI RCATGY 1 cut(s) 137
BsuI GTATCC 1 cut(s) 26
BsuRI GGCC 1 cut(s) 158
BtsCI GGATG 1 cut(s) 61
Cfr13I GGNCC 2 cut(s) 45, 157
CseI GACGC 1 cut(s) 113
CviAII CATG 1 cut(s) 134
CviJI RGCY 1 cut(s) 158
CviKI_1 RGCY 1 cut(s) 158
DdeI CTNAG 1 cut(s) 67
Eco130I CCWWGG 1 cut(s) 48
Eco31I GGTCTC 1 cut(s) 11
Eco47I GGWCC 1 cut(s) 45
EcoT14I CCWWGG 1 cut(s) 48
ErhI CCWWGG 1 cut(s) 48
FaeI CATG 1 cut(s) 137
FaiI YATR 6 cut(s) 87, 120, 122, 124, 135, 165
FatI CATG 1 cut(s) 133
FokI GGATG 1 cut(s) 68
HaeIII GGCC 1 cut(s) 158
HapII CCGG 1 cut(s) 108
HgaI GACGC 1 cut(s) 113
Hin1I GRCGYC 1 cut(s) 105
Hin1II CATG 1 cut(s) 137
HpaII CCGG 1 cut(s) 108
Hpy166II GTNNAC 2 cut(s) 92, 153
Hpy188III TCNNGA 1 cut(s) 62
Hpy8I GTNNAC 2 cut(s) 92, 153
Hpy99I CGWCG 1 cut(s) 107
HpyCH4V TGCA 2 cut(s) 126, 137
HpyF10VI GCNNNNNNNGC 1 cut(s) 164
HpyF3I CTNAG 1 cut(s) 67
Hsp92I GRCGYC 1 cut(s) 105
Hsp92II CATG 1 cut(s) 137
LpnPI CCDG 1 cut(s) 121
MaeIII GTNAC 1 cut(s) 62
MfeI CAATTG 1 cut(s) 138
MluCI AATT 2 cut(s) 37, 138
MnlI CCTC 1 cut(s) 138
MspI CCGG 1 cut(s) 108
MunI CAATTG 1 cut(s) 138
MwoI GCNNNNNNNGC 1 cut(s) 164
NlaIII CATG 1 cut(s) 137
NmuCI GTSAC 1 cut(s) 62
NspI RCATGY 1 cut(s) 137
PflFI GACNNNGTC 1 cut(s) 68
PspPI GGNCC 2 cut(s) 45, 157
PsyI GACNNNGTC 1 cut(s) 68
Sau96I GGNCC 2 cut(s) 45, 157
SetI ASST 3 cut(s) 16, 50, 149
SgeI CNNG 6 cut(s) 61, 74, 92, 107, 120, 146
SinI GGWCC 1 cut(s) 45
Sse9I AATT 2 cut(s) 37, 138
StyI CCWWGG 1 cut(s) 48
TaqI TCGA 2 cut(s) 72, 102
TasI AATT 2 cut(s) 37, 138
TseFI GTSAC 1 cut(s) 62
Tsp45I GTSAC 1 cut(s) 62
Tth111I GACNNNGTC 1 cut(s) 68
VpaK11BI GGWCC 1 cut(s) 45
XceI RCATGY 1 cut(s) 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.