Rorug03G0322000

No description available

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Reverse (-)
34965501 .. 34967489
1989 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0322000.1

Sequence Viewer

Length: 588 bp
ATGACCTCGAGGGTTTTGGTTGGCATTCGTAAGCTGCTTGCTGGAACTTCAATCCCAACCTCCCAATCATCTTACAGACCCCTCCACACTTTAGCCGTCGCTGGCCGAGATTCTAGAGCCAAGGATTTGAGGCGCCTCGCCTCATTGATTCCATTGCAACCCATTTACGGACATTCAGGGGATTTGACATTCGATAAAATTCGAGATACATCTTTGCAAGCAGTCTGCTGCTTCTATGGCACGAGTGGCTTTAGCACTAGGTACGCACCTCCAATCATTCAAAGGCTGGTGGACCAATTCCCTTCTGTAAAAGCATTTTATTTTGTCATTGAAGACAATGATGAGGATTTACCTGATGATTTCACAAAGACAGCGTTGAACATTTCAAGTCTGCCAATGTTTCATTTCTATCAAAATGGGGAAAAGGTAGAGGAGCTAGCTGGTGATTTTATCAGGCGCTTCAAGACAGTTCTTGAAAAACTTTACAACCCTCAAAAAGTTGGCACAAAAGCCCAGGAAAATGTGATGCGTGAAGGCATTGTTGGAGGAAGGAACAAGGAGGAACAAATGATTGGCCTCGTGGACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

195

Amino Acids

21.92

Weight (kDa)

8.5

Isoelectric Point (pI)

42.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AbsI CCTCGAGG 1 cut(s) 7
AccB1I GGYRCC 1 cut(s) 132
AcoI YGGCCR 1 cut(s) 103
AcsI RAATTY 1 cut(s) 198
AcyI GRCGYC 1 cut(s) 133
AfaI GTAC 1 cut(s) 263
AfiI CCNNNNNNNGG 1 cut(s) 167
AgsI TTSAA 7 cut(s) 51, 281, 332, 379, 387, 463, 476
AjnI CCWGG 1 cut(s) 513
AjuI GAANNNNNNNTTGG 4 cut(s) 525, 555, 557, 587
AluBI AGCT 3 cut(s) 34, 436, 440
AluI AGCT 3 cut(s) 34, 436, 440
Ama87I CYCGRG 1 cut(s) 7
AoxI GGCC 2 cut(s) 103, 574
ApeKI GCWGC 2 cut(s) 34, 228
ApoI RAATTY 1 cut(s) 198
AspLEI GCGC 2 cut(s) 135, 459
AspS9I GGNCC 1 cut(s) 292
AsuHPI GGTGA 1 cut(s) 455
AsuNHI GCTAGC 1 cut(s) 436
AvaI CYCGRG 1 cut(s) 7
AvaII GGWCC 1 cut(s) 292
BanI GGYRCC 1 cut(s) 132
BauI CACGAG 2 cut(s) 241, 578
BbsI GAAGAC 1 cut(s) 339
BbvI GCAGC 2 cut(s) 21, 215
BceAI ACGGC 1 cut(s) 80
BciT130I CCWGG 1 cut(s) 515
BfaI CTAG 3 cut(s) 114, 258, 437
BfoI RGCGCY 2 cut(s) 136, 460
BisI GCNGC 2 cut(s) 35, 229
BlsI GCNGC 2 cut(s) 36, 230
Bme1390I CCNGG 1 cut(s) 515
Bme18I GGWCC 1 cut(s) 292
BmeT110I CYCGRG 1 cut(s) 7
BmgT120I GGNCC 1 cut(s) 292
BmiI GGNNCC 1 cut(s) 134
BmrFI CCNGG 1 cut(s) 515
BmsI GCATC 1 cut(s) 516
BmtI GCTAGC 1 cut(s) 440
BpiI GAAGAC 1 cut(s) 339
BsaHI GRCGYC 1 cut(s) 133
BsaJI CCNNGG 2 cut(s) 120, 513
Bsc4I CCNNNNNNNGG 1 cut(s) 167
Bse3DI GCAATG 1 cut(s) 152
BseBI CCWGG 1 cut(s) 515
BseDI CCNNGG 2 cut(s) 120, 513
BseLI CCNNNNNNNGG 1 cut(s) 167
BseMI GCAATG 1 cut(s) 152
BseRI GAGGAG 1 cut(s) 446
BseXI GCAGC 2 cut(s) 21, 215
BshFI GGCC 2 cut(s) 105, 576
BshNI GGYRCC 1 cut(s) 132
BsiHKCI CYCGRG 1 cut(s) 7
BslI CCNNNNNNNGG 1 cut(s) 167
BsmI GAATGC 1 cut(s) 24
BsnI GGCC 2 cut(s) 105, 576
BsoBI CYCGRG 1 cut(s) 7
BspANI GGCC 2 cut(s) 105, 576
BspLI GGNNCC 1 cut(s) 134
BspOI GCTAGC 1 cut(s) 440
BspT107I GGYRCC 1 cut(s) 132
BsrDI GCAATG 1 cut(s) 152
BssECI CCNNGG 2 cut(s) 120, 513
BssNI GRCGYC 1 cut(s) 133
BssSI CACGAG 2 cut(s) 241, 578
BssT1I CCWWGG 1 cut(s) 120
Bst2BI CACGAG 2 cut(s) 241, 578
Bst2UI CCWGG 1 cut(s) 515
Bst4CI ACNGT 1 cut(s) 469
BstACI GRCGYC 1 cut(s) 133
BstC8I GCNNGC 4 cut(s) 39, 103, 219, 438
BstH2I RGCGCY 2 cut(s) 136, 460
BstHHI GCGC 2 cut(s) 135, 459
BstMWI GCNNNNNNNGC 2 cut(s) 237, 246
BstNI CCWGG 1 cut(s) 515
BstSCI CCNGG 1 cut(s) 513
BstV1I GCAGC 2 cut(s) 21, 215
BstV2I GAAGAC 1 cut(s) 339
BsuRI GGCC 2 cut(s) 105, 576
Cac8I GCNNGC 4 cut(s) 39, 103, 219, 438
CfoI GCGC 2 cut(s) 135, 459
Cfr13I GGNCC 1 cut(s) 292
Csp6I GTAC 1 cut(s) 262
CviQI GTAC 1 cut(s) 262
DinI GGCGCC 1 cut(s) 134
EaeI YGGCCR 1 cut(s) 103
Eco130I CCWWGG 1 cut(s) 120
Eco47I GGWCC 1 cut(s) 292
Eco88I CYCGRG 1 cut(s) 7
EcoRII CCWGG 1 cut(s) 513
EcoT14I CCWWGG 1 cut(s) 120
EgeI GGCGCC 1 cut(s) 134
EheI GGCGCC 1 cut(s) 134
ErhI CCWWGG 1 cut(s) 120
FaiI YATR 1 cut(s) 237
Fnu4HI GCNGC 2 cut(s) 35, 229
Fsp4HI GCNGC 2 cut(s) 35, 229
FspBI CTAG 3 cut(s) 114, 258, 437
GlaI GCGC 2 cut(s) 134, 458
GluI GCNGC 2 cut(s) 35, 229
HaeII RGCGCY 2 cut(s) 136, 460
HaeIII GGCC 2 cut(s) 105, 576
HhaI GCGC 2 cut(s) 135, 459
Hin1I GRCGYC 1 cut(s) 133
Hin6I GCGC 2 cut(s) 133, 457
HinP1I GCGC 2 cut(s) 133, 457
HinfI GANTC 2 cut(s) 110, 148
HphI GGTGA 1 cut(s) 455
Hpy166II GTNNAC 2 cut(s) 292, 583
Hpy188III TCNNGA 4 cut(s) 114, 203, 463, 473
Hpy8I GTNNAC 2 cut(s) 292, 583
Hpy99I CGWCG 1 cut(s) 101
HpyAV CCTTC 3 cut(s) 312, 527, 543
HpyCH4III ACNGT 1 cut(s) 469
HpyCH4V TGCA 2 cut(s) 157, 217
HpyF10VI GCNNNNNNNGC 2 cut(s) 237, 246
Hsp92I GRCGYC 1 cut(s) 133
HspAI GCGC 2 cut(s) 133, 457
KasI GGCGCC 1 cut(s) 132
LmnI GCTCC 1 cut(s) 433
LpnPI CCDG 9 cut(s) 27, 87, 162, 272, 366, 426, 439, 500, 527
Lsp1109I GCAGC 2 cut(s) 21, 215
LweI GCATC 1 cut(s) 516
MaeI CTAG 3 cut(s) 114, 258, 437
MboII GAAGA 1 cut(s) 344
MluCI AATT 2 cut(s) 198, 296
Mly113I GGCGCC 1 cut(s) 133
MmeI TCCRAC 1 cut(s) 523
MspR9I CCNGG 1 cut(s) 515
Mva1269I GAATGC 1 cut(s) 24
MvaI CCWGG 1 cut(s) 515
MwoI GCNNNNNNNGC 2 cut(s) 237, 246
NarI GGCGCC 1 cut(s) 133
NheI GCTAGC 1 cut(s) 436
NlaIV GGNNCC 1 cut(s) 134
NmeAIII GCCGAG 1 cut(s) 131
PaeR7I CTCGAG 1 cut(s) 7
PctI GAATGC 1 cut(s) 24
PfeI GAWTC 2 cut(s) 110, 148
PkrI GCNGC 2 cut(s) 36, 230
PluTI GGCGCC 1 cut(s) 136
Psp6I CCWGG 1 cut(s) 513
PspGI CCWGG 1 cut(s) 513
PspN4I GGNNCC 1 cut(s) 134
PspPI GGNCC 1 cut(s) 292
PspXI VCTCGAGB 1 cut(s) 7
RsaI GTAC 1 cut(s) 263
RsaNI GTAC 1 cut(s) 262
SatI GCNGC 2 cut(s) 35, 229
Sau96I GGNCC 1 cut(s) 292
ScrFI CCNGG 1 cut(s) 515
SetI ASST 9 cut(s) 8, 36, 62, 263, 271, 355, 429, 438, 442
SfaNI GCATC 1 cut(s) 516
SfoI GGCGCC 1 cut(s) 134
Sfr274I CTCGAG 1 cut(s) 7
SinI GGWCC 1 cut(s) 292
SlaI CTCGAG 1 cut(s) 7
SmlI CTYRAG 1 cut(s) 7
SmoI CTYRAG 1 cut(s) 7
Sse9I AATT 2 cut(s) 198, 296
SspDI GGCGCC 1 cut(s) 132
SspMI CTAG 3 cut(s) 114, 258, 437
StyD4I CCNGG 1 cut(s) 513
StyI CCWWGG 1 cut(s) 120
TaaI ACNGT 1 cut(s) 469
TaqI TCGA 3 cut(s) 8, 192, 202
TasI AATT 2 cut(s) 198, 296
TfiI GAWTC 2 cut(s) 110, 148
TseI GCWGC 2 cut(s) 34, 228
TspDTI ATGAA 1 cut(s) 392
TspGWI ACGGA 1 cut(s) 183
VpaK11BI GGWCC 1 cut(s) 292
XapI RAATTY 1 cut(s) 198
XbaI TCTAGA 1 cut(s) 113
XhoI CTCGAG 1 cut(s) 7
XspI CTAG 3 cut(s) 114, 258, 437
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.