Rh4BG147300

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
OG0001040
Physical Location & Seq
Reverse (-)
26295005 .. 26295343
339 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG147300.1

Sequence Viewer

Length: 339 bp
ATGCCTTTGACACCCGCTCATCCCTACCATTCAATTTGCTTTGCAGAACCAGGGAAAGGTGGCCTAGCTGTTGGCTACACGGCTAAAGGGTTGGTGGGTTATGTCTTTGATCATGATGGCAACTTGCTATTTCAACAGCTGCTCCAGCATCATAATCTTCGTCTTCCACCTCCAGATCAGATAAGGTTTGGGGGAAAAGTTCTTTATGTAGGTGGTGACAAGTATTGTCTCATTTTGTCAGGAAAAATTTACAAACCTTCATGTTCGTTAGCGGTGGCAACCTTTAGTCTGGCTTTTTTTGATGGTCTATTCCACCAAGTTGAACTATCTTATCATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

112

Amino Acids

12.32

Weight (kDa)

7.78

Isoelectric Point (pI)

33.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 17
AciI CCGC 2 cut(s) 15, 272
AcsI RAATTY 1 cut(s) 246
AfiI CCNNNNNNNGG 1 cut(s) 56
AgsI TTSAA 3 cut(s) 33, 134, 323
AjnI CCWGG 1 cut(s) 49
AluBI AGCT 2 cut(s) 68, 139
AluI AGCT 2 cut(s) 68, 139
Alw26I GTCTC 1 cut(s) 233
AoxI GGCC 1 cut(s) 61
ApeKI GCWGC 1 cut(s) 139
ApoI RAATTY 1 cut(s) 246
AsuHPI GGTGA 1 cut(s) 227
BbsI GAAGAC 1 cut(s) 155
BbvI GCAGC 1 cut(s) 126
BccI CCATC 2 cut(s) 110, 296
BceAI ACGGC 1 cut(s) 96
BciT130I CCWGG 1 cut(s) 51
BclI TGATCA 1 cut(s) 109
BcoDI GTCTC 1 cut(s) 233
BfaI CTAG 1 cut(s) 65
BisI GCNGC 1 cut(s) 140
BlsI GCNGC 1 cut(s) 141
Bme1390I CCNGG 1 cut(s) 51
BmrFI CCNGG 1 cut(s) 51
BmsI GCATC 1 cut(s) 157
BpiI GAAGAC 1 cut(s) 155
BpmI CTGGAG 2 cut(s) 128, 156
BsaJI CCNNGG 1 cut(s) 50
BsaXI ACNNNNNCTCC 2 cut(s) 126, 156
Bsc4I CCNNNNNNNGG 1 cut(s) 56
BseBI CCWGG 1 cut(s) 51
BseDI CCNNGG 1 cut(s) 50
BseGI GGATG 1 cut(s) 19
BseLI CCNNNNNNNGG 1 cut(s) 56
BseXI GCAGC 1 cut(s) 126
BshFI GGCC 1 cut(s) 63
BslI CCNNNNNNNGG 1 cut(s) 56
BsmAI GTCTC 1 cut(s) 233
BsnI GGCC 1 cut(s) 63
Bsp143I GATC 2 cut(s) 109, 175
BspACI CCGC 2 cut(s) 15, 272
BspANI GGCC 1 cut(s) 63
BspHI TCATGA 1 cut(s) 112
BsrBI CCGCTC 1 cut(s) 17
BssECI CCNNGG 1 cut(s) 50
BssMI GATC 2 cut(s) 109, 175
Bst2UI CCWGG 1 cut(s) 51
BstF5I GGATG 1 cut(s) 19
BstKTI GATC 2 cut(s) 112, 178
BstMAI GTCTC 1 cut(s) 233
BstMBI GATC 2 cut(s) 109, 175
BstMWI GCNNNNNNNGC 1 cut(s) 145
BstNI CCWGG 1 cut(s) 51
BstSCI CCNGG 1 cut(s) 49
BstV1I GCAGC 1 cut(s) 126
BstV2I GAAGAC 1 cut(s) 155
BsuRI GGCC 1 cut(s) 63
BtsCI GGATG 1 cut(s) 19
CciI TCATGA 1 cut(s) 112
CviAII CATG 2 cut(s) 113, 261
CviJI RGCY 6 cut(s) 63, 68, 75, 83, 139, 293
CviKI_1 RGCY 6 cut(s) 63, 68, 75, 83, 139, 293
DpnI GATC 2 cut(s) 111, 177
DpnII GATC 2 cut(s) 109, 175
EcoRII CCWGG 1 cut(s) 49
FaeI CATG 2 cut(s) 116, 264
FaiI YATR 5 cut(s) 102, 114, 153, 207, 262
FatI CATG 2 cut(s) 112, 260
FauI CCCGC 1 cut(s) 22
FbaI TGATCA 1 cut(s) 109
Fnu4HI GCNGC 1 cut(s) 140
FokI GGATG 1 cut(s) 6
Fsp4HI GCNGC 1 cut(s) 140
FspBI CTAG 1 cut(s) 65
GluI GCNGC 1 cut(s) 140
GsuI CTGGAG 2 cut(s) 128, 156
HaeIII GGCC 1 cut(s) 63
Hin1II CATG 2 cut(s) 116, 264
HphI GGTGA 1 cut(s) 227
Hpy188I TCNGA 1 cut(s) 180
Hpy188III TCNNGA 3 cut(s) 113, 173, 240
HpyAV CCTTC 1 cut(s) 267
HpyCH4V TGCA 1 cut(s) 44
HpyF10VI GCNNNNNNNGC 1 cut(s) 145
Hsp92II CATG 2 cut(s) 116, 264
Ksp22I TGATCA 1 cut(s) 109
Kzo9I GATC 2 cut(s) 109, 175
LmnI GCTCC 1 cut(s) 147
LpnPI CCDG 6 cut(s) 36, 63, 158, 186, 225, 275
Lsp1109I GCAGC 1 cut(s) 126
LweI GCATC 1 cut(s) 157
MaeI CTAG 1 cut(s) 65
MaeIII GTNAC 1 cut(s) 215
MalI GATC 2 cut(s) 111, 177
MbiI CCGCTC 1 cut(s) 17
MboI GATC 2 cut(s) 109, 175
MboII GAAGA 2 cut(s) 149, 155
MluCI AATT 2 cut(s) 33, 246
MnlI CCTC 1 cut(s) 180
MseI TTAA 1 cut(s) 337
MspA1I CMGCKG 1 cut(s) 139
MspR9I CCNGG 1 cut(s) 51
MvaI CCWGG 1 cut(s) 51
MwoI GCNNNNNNNGC 1 cut(s) 145
NdeII GATC 2 cut(s) 109, 175
NlaIII CATG 2 cut(s) 116, 264
NmuCI GTSAC 1 cut(s) 215
PagI TCATGA 1 cut(s) 112
PkrI GCNGC 1 cut(s) 141
Psp6I CCWGG 1 cut(s) 49
PspGI CCWGG 1 cut(s) 49
PvuII CAGCTG 1 cut(s) 139
SaqAI TTAA 1 cut(s) 337
SatI GCNGC 1 cut(s) 140
Sau3AI GATC 2 cut(s) 109, 175
ScrFI CCNGG 1 cut(s) 51
SetI ASST 8 cut(s) 61, 70, 141, 172, 188, 214, 259, 284
SfaNI GCATC 1 cut(s) 157
Sse9I AATT 2 cut(s) 33, 246
SsiI CCGC 2 cut(s) 15, 272
SspMI CTAG 1 cut(s) 65
StyD4I CCNGG 1 cut(s) 49
TasI AATT 2 cut(s) 33, 246
Tru1I TTAA 1 cut(s) 337
Tru9I TTAA 1 cut(s) 337
TseFI GTSAC 1 cut(s) 215
TseI GCWGC 1 cut(s) 139
Tsp45I GTSAC 1 cut(s) 215
TspDTI ATGAA 1 cut(s) 249
XapI RAATTY 1 cut(s) 246
XspI CTAG 1 cut(s) 65
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.