Rh6AG011000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Forward (+)
1189426 .. 1190617
1192 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG011000.1

Sequence Viewer

Length: 321 bp
ATGGCGGAGAATGAAAGCTACAAGCGTGGGTTACTCCACTCTTTGAACAAAAACCCTGATCTTCCCTCTGCGTGTCAGGTCAACTTTGGCGGAAAGACCCAGCGTCATGGCATAGTATTGGGGGAAGCAACATTTGATGTGAAGTTTAAGATTGCCAATGGTGATGGAGGAGGGAAAGGCTTCTACCATGAAAATCCACTGCATTATCATCACTTTAACGATATTGATTCATGGTTTACTAATCCATATCAGTTTGGGAAGAAGTACCGGAATCCAAGGCTTTATAGTTACTATGAATTCCAGGATGCTTTCACTATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

106

Amino Acids

12.29

Weight (kDa)

7.88

Isoelectric Point (pI)

26.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 5, 90
AcsI RAATTY 1 cut(s) 296
AfaI GTAC 1 cut(s) 266
AgsI TTSAA 1 cut(s) 46
AhdI GACNNNNNGTC 1 cut(s) 102
AjnI CCWGG 1 cut(s) 300
AluBI AGCT 1 cut(s) 18
AluI AGCT 1 cut(s) 18
ApoI RAATTY 1 cut(s) 296
Asp700I GAANNNNTTC 1 cut(s) 179
AsuHPI GGTGA 1 cut(s) 173
BccI CCATC 1 cut(s) 158
BciT130I CCWGG 1 cut(s) 302
Bme1390I CCNGG 1 cut(s) 302
BmeRI GACNNNNNGTC 1 cut(s) 102
BmrFI CCNGG 1 cut(s) 302
BmsI GCATC 1 cut(s) 295
BsaJI CCNNGG 1 cut(s) 275
BsaWI WCCGGW 1 cut(s) 267
BseBI CCWGG 1 cut(s) 302
BseDI CCNNGG 1 cut(s) 275
BseGI GGATG 1 cut(s) 310
BseRI GAGGAG 1 cut(s) 183
BseYI CCCAGC 1 cut(s) 99
BsiSI CCGG 1 cut(s) 268
Bsp143I GATC 1 cut(s) 58
BspACI CCGC 2 cut(s) 5, 90
BssECI CCNNGG 1 cut(s) 275
BssMI GATC 1 cut(s) 58
BssT1I CCWWGG 1 cut(s) 275
Bst2UI CCWGG 1 cut(s) 302
BstF5I GGATG 1 cut(s) 310
BstKTI GATC 1 cut(s) 61
BstMBI GATC 1 cut(s) 58
BstNI CCWGG 1 cut(s) 302
BstSCI CCNGG 1 cut(s) 300
BstXI CCANNNNNNTGG 1 cut(s) 107
BtsCI GGATG 1 cut(s) 310
BtsI GCAGTG 1 cut(s) 197
BtsIMutI CAGTG 1 cut(s) 197
CseI GACGC 1 cut(s) 92
Csp6I GTAC 1 cut(s) 265
CviAII CATG 3 cut(s) 107, 188, 231
CviJI RGCY 3 cut(s) 18, 180, 280
CviKI_1 RGCY 3 cut(s) 18, 180, 280
CviQI GTAC 1 cut(s) 265
DpnI GATC 1 cut(s) 60
DpnII GATC 1 cut(s) 58
DriI GACNNNNNGTC 1 cut(s) 102
Eam1105I GACNNNNNGTC 1 cut(s) 102
EciI GGCGGA 2 cut(s) 20, 105
Eco130I CCWWGG 1 cut(s) 275
EcoRI GAATTC 1 cut(s) 296
EcoRII CCWGG 1 cut(s) 300
EcoT14I CCWWGG 1 cut(s) 275
ErhI CCWWGG 1 cut(s) 275
FaeI CATG 3 cut(s) 110, 191, 234
FaiI YATR 8 cut(s) 108, 113, 189, 232, 247, 285, 294, 317
FatI CATG 3 cut(s) 106, 187, 230
FokI GGATG 1 cut(s) 317
GsaI CCCAGC 1 cut(s) 103
HapII CCGG 1 cut(s) 268
HgaI GACGC 1 cut(s) 92
Hin1II CATG 3 cut(s) 110, 191, 234
HincII GTYRAC 1 cut(s) 82
HindII GTYRAC 1 cut(s) 82
HinfI GANTC 2 cut(s) 227, 271
HpaII CCGG 1 cut(s) 268
HphI GGTGA 1 cut(s) 173
Hpy166II GTNNAC 2 cut(s) 82, 237
Hpy8I GTNNAC 2 cut(s) 82, 237
HpyCH4V TGCA 1 cut(s) 202
Hsp92II CATG 3 cut(s) 110, 191, 234
Kzo9I GATC 1 cut(s) 58
LpnPI CCDG 6 cut(s) 62, 69, 113, 281, 287, 314
LweI GCATC 1 cut(s) 295
MaeIII GTNAC 2 cut(s) 30, 287
MalI GATC 1 cut(s) 60
MboI GATC 1 cut(s) 58
MboII GAAGA 2 cut(s) 53, 271
MluCI AATT 1 cut(s) 296
MnlI CCTC 3 cut(s) 76, 161, 164
MroXI GAANNNNTTC 1 cut(s) 179
MseI TTAA 2 cut(s) 147, 216
MspI CCGG 1 cut(s) 268
MspR9I CCNGG 1 cut(s) 302
MvaI CCWGG 1 cut(s) 302
NdeII GATC 1 cut(s) 58
NlaIII CATG 3 cut(s) 110, 191, 234
PdmI GAANNNNTTC 1 cut(s) 179
PfeI GAWTC 2 cut(s) 227, 271
PfoI TCCNGGA 1 cut(s) 300
Psp6I CCWGG 1 cut(s) 300
PspFI CCCAGC 1 cut(s) 99
PspGI CCWGG 1 cut(s) 300
RsaI GTAC 1 cut(s) 266
RsaNI GTAC 1 cut(s) 265
SaqAI TTAA 2 cut(s) 147, 216
Sau3AI GATC 1 cut(s) 58
ScrFI CCNGG 1 cut(s) 302
SetI ASST 2 cut(s) 20, 81
SfaNI GCATC 1 cut(s) 295
Sse9I AATT 1 cut(s) 296
SsiI CCGC 2 cut(s) 5, 90
StyD4I CCNGG 1 cut(s) 300
StyI CCWWGG 1 cut(s) 275
TasI AATT 1 cut(s) 296
TfiI GAWTC 2 cut(s) 227, 271
Tru1I TTAA 2 cut(s) 147, 216
Tru9I TTAA 2 cut(s) 147, 216
TscAI CASTG 1 cut(s) 204
TspDTI ATGAA 4 cut(s) 27, 204, 219, 309
TspRI CASTG 1 cut(s) 204
XapI RAATTY 1 cut(s) 296
XmnI GAANNNNTTC 1 cut(s) 179
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.