Rh6DG009900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Forward (+)
994818 .. 995141
324 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG009900.1

Sequence Viewer

Length: 324 bp
ATGGGTTCGGATAATGAAATCGAAACAGAGGAAGGAGAAGACTTGAAGCCTATGCAACTTGGTCGGCCCTTCCATTCCGTTTGCTTTGCTGAACCAGGTAAAGGGGGCTTTGCCATTGGCTATACTGCTAACGGGTTAGCGGGTTACTTCTTTGCTCCTGATGGCAAGCTGCAGTTTCAAGGGCTACTCCACTCTTTGATCAAAAACTCTGATCTTCCCTCTGCGTATCAGGCCAACTTTAAGGTTGTCCATGCGGGTGGCAGCAACTTCTGCCTTGTGTTGTATGGTTGTATTATAGACCCAGCGTCATGGTTTTGGGGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

107

Amino Acids

11.56

Weight (kDa)

4.9

Isoelectric Point (pI)

22.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 140, 254
AfiI CCNNNNNNNGG 1 cut(s) 101
AgsI TTSAA 2 cut(s) 46, 179
AhdI GACNNNNNGTC 1 cut(s) 304
AjnI CCWGG 1 cut(s) 94
AluBI AGCT 1 cut(s) 169
AluI AGCT 1 cut(s) 169
AoxI GGCC 2 cut(s) 65, 231
ApeKI GCWGC 2 cut(s) 169, 261
AspS9I GGNCC 1 cut(s) 66
BbsI GAAGAC 1 cut(s) 45
BbvI GCAGC 2 cut(s) 156, 273
BccI CCATC 1 cut(s) 155
BcgI CGANNNNNNTGC 2 cut(s) 44, 78
BciT130I CCWGG 1 cut(s) 96
BclI TGATCA 1 cut(s) 198
BfmI CTRYAG 1 cut(s) 170
BisI GCNGC 2 cut(s) 170, 262
BlsI GCNGC 2 cut(s) 171, 263
Bme1390I CCNGG 1 cut(s) 96
BmeRI GACNNNNNGTC 1 cut(s) 304
BmgT120I GGNCC 1 cut(s) 66
BmrFI CCNGG 1 cut(s) 96
BpiI GAAGAC 1 cut(s) 45
Bsc4I CCNNNNNNNGG 1 cut(s) 101
BseBI CCWGG 1 cut(s) 96
BseLI CCNNNNNNNGG 1 cut(s) 101
BseXI GCAGC 2 cut(s) 156, 273
BseYI CCCAGC 1 cut(s) 301
BshFI GGCC 2 cut(s) 67, 233
BslI CCNNNNNNNGG 1 cut(s) 101
BsnI GGCC 2 cut(s) 67, 233
Bsp143I GATC 2 cut(s) 198, 211
BspACI CCGC 2 cut(s) 140, 254
BspANI GGCC 2 cut(s) 67, 233
BspMAI CTGCAG 1 cut(s) 174
BssMI GATC 2 cut(s) 198, 211
Bst2UI CCWGG 1 cut(s) 96
BstAPI GCANNNNNTGC 1 cut(s) 270
BstC8I GCNNGC 1 cut(s) 167
BstKTI GATC 2 cut(s) 201, 214
BstMBI GATC 2 cut(s) 198, 211
BstMWI GCNNNNNNNGC 2 cut(s) 230, 270
BstNI CCWGG 1 cut(s) 96
BstSCI CCNGG 1 cut(s) 94
BstSFI CTRYAG 1 cut(s) 170
BstV1I GCAGC 2 cut(s) 156, 273
BstV2I GAAGAC 1 cut(s) 45
BstXI CCANNNNNNTGG 2 cut(s) 257, 309
BsuRI GGCC 2 cut(s) 67, 233
Cac8I GCNNGC 1 cut(s) 167
Cfr13I GGNCC 1 cut(s) 66
CseI GACGC 1 cut(s) 294
CsiI ACCWGGT 1 cut(s) 94
CviAII CATG 2 cut(s) 251, 309
CviJI RGCY 7 cut(s) 49, 67, 108, 120, 169, 184, 233
CviKI_1 RGCY 7 cut(s) 49, 67, 108, 120, 169, 184, 233
DpnI GATC 2 cut(s) 200, 213
DpnII GATC 2 cut(s) 198, 211
DriI GACNNNNNGTC 1 cut(s) 304
Eam1105I GACNNNNNGTC 1 cut(s) 304
EcoRII CCWGG 1 cut(s) 94
FaeI CATG 2 cut(s) 254, 312
FaiI YATR 6 cut(s) 53, 123, 252, 285, 296, 310
FatI CATG 2 cut(s) 250, 308
FauI CCCGC 2 cut(s) 133, 247
FbaI TGATCA 1 cut(s) 198
Fnu4HI GCNGC 2 cut(s) 170, 262
Fsp4HI GCNGC 2 cut(s) 170, 262
GluI GCNGC 2 cut(s) 170, 262
GsaI CCCAGC 1 cut(s) 305
HaeIII GGCC 2 cut(s) 67, 233
HgaI GACGC 1 cut(s) 294
Hin1II CATG 2 cut(s) 254, 312
Hpy188I TCNGA 2 cut(s) 10, 211
Hpy188III TCNNGA 1 cut(s) 158
HpyAV CCTTC 2 cut(s) 26, 79
HpyCH4V TGCA 2 cut(s) 55, 172
HpyF10VI GCNNNNNNNGC 2 cut(s) 230, 270
Hsp92II CATG 2 cut(s) 254, 312
Ksp22I TGATCA 1 cut(s) 198
Kzo9I GATC 2 cut(s) 198, 211
LmnI GCTCC 1 cut(s) 160
LpnPI CCDG 5 cut(s) 81, 108, 171, 215, 315
Lsp1109I GCAGC 2 cut(s) 156, 273
MabI ACCWGGT 1 cut(s) 94
MaeIII GTNAC 1 cut(s) 143
MalI GATC 2 cut(s) 200, 213
MboI GATC 2 cut(s) 198, 211
MboII GAAGA 2 cut(s) 50, 206
MnlI CCTC 2 cut(s) 22, 229
MseI TTAA 1 cut(s) 240
MslI CAYNNNNRTG 1 cut(s) 255
MspR9I CCNGG 1 cut(s) 96
MvaI CCWGG 1 cut(s) 96
MwoI GCNNNNNNNGC 2 cut(s) 230, 270
NdeII GATC 2 cut(s) 198, 211
NlaIII CATG 2 cut(s) 254, 312
PkrI GCNGC 2 cut(s) 171, 263
Psp6I CCWGG 1 cut(s) 94
PspFI CCCAGC 1 cut(s) 301
PspGI CCWGG 1 cut(s) 94
PspPI GGNCC 1 cut(s) 66
PstI CTGCAG 1 cut(s) 174
RseI CAYNNNNRTG 1 cut(s) 255
SaqAI TTAA 1 cut(s) 240
SatI GCNGC 2 cut(s) 170, 262
Sau3AI GATC 2 cut(s) 198, 211
Sau96I GGNCC 1 cut(s) 66
ScrFI CCNGG 1 cut(s) 96
SetI ASST 3 cut(s) 100, 171, 246
SexAI ACCWGGT 1 cut(s) 94
SfcI CTRYAG 1 cut(s) 170
SmiMI CAYNNNNRTG 1 cut(s) 255
SsiI CCGC 2 cut(s) 140, 254
StyD4I CCNGG 1 cut(s) 94
TaqI TCGA 1 cut(s) 21
Tru1I TTAA 1 cut(s) 240
Tru9I TTAA 1 cut(s) 240
TseI GCWGC 2 cut(s) 169, 261
TspDTI ATGAA 1 cut(s) 30
TspGWI ACGGA 1 cut(s) 67
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.