Rorug04G0355000

SAM domain (Sterile alpha motif)

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Forward (+)
52722405 .. 52722575
171 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0355000.1

Sequence Viewer

Length: 171 bp
ATGCAATTTCGGTGCTCTCATATTTTTCGGGAAGGGAATCAAGTTGCAGATGCTCTTGCAAACTTTGGTCTCACTTCAGATACTATGGTTTGGTGGGACTCGCCCCCAGATTTTGTTGCTTCTTTTTGCAATAGATATTTTATGGGGCTTCCTAATTTTCGCTTTCGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

56

Amino Acids

6.6

Weight (kDa)

6.51

Isoelectric Point (pI)

15.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 60
Alw21I GWGCWC 1 cut(s) 17
Alw26I GTCTC 1 cut(s) 74
BaeI ACNNNNGTAYC 2 cut(s) 72, 105
Bbv12I GWGCWC 1 cut(s) 17
BcoDI GTCTC 1 cut(s) 74
BmsI GCATC 1 cut(s) 40
BsaI GGTCTC 1 cut(s) 74
BsiHKAI GWGCWC 1 cut(s) 17
BslFI GGGAC 1 cut(s) 110
BsmAI GTCTC 1 cut(s) 74
BsmFI GGGAC 1 cut(s) 110
Bso31I GGTCTC 1 cut(s) 74
Bsp1286I GDGCHC 1 cut(s) 17
BspTNI GGTCTC 1 cut(s) 74
BstMAI GTCTC 1 cut(s) 74
CviJI RGCY 1 cut(s) 148
CviKI_1 RGCY 1 cut(s) 148
Eco31I GGTCTC 1 cut(s) 74
Eco57I CTGAAG 1 cut(s) 60
FaiI YATR 3 cut(s) 21, 86, 143
FaqI GGGAC 1 cut(s) 110
HinfI GANTC 2 cut(s) 37, 98
Hpy188I TCNGA 1 cut(s) 79
Hpy188III TCNNGA 1 cut(s) 29
HpyAV CCTTC 1 cut(s) 26
HpyCH4V TGCA 4 cut(s) 4, 47, 59, 129
LpnPI CCDG 1 cut(s) 120
LweI GCATC 1 cut(s) 40
MhlI GDGCHC 1 cut(s) 17
MluCI AATT 2 cut(s) 5, 154
MlyI GAGTC 1 cut(s) 92
PfeI GAWTC 1 cut(s) 37
PleI GAGTC 1 cut(s) 92
PpsI GAGTC 1 cut(s) 92
SchI GAGTC 1 cut(s) 92
SduI GDGCHC 1 cut(s) 17
SfaNI GCATC 1 cut(s) 40
SgeI CNNG 5 cut(s) 41, 53, 68, 112, 119
Sse9I AATT 2 cut(s) 5, 154
TasI AATT 2 cut(s) 5, 154
TfiI GAWTC 1 cut(s) 37
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.