Rh5DG318000

SAM domain (Sterile alpha motif)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
OG0001403
Physical Location & Seq
Reverse (-)
40929698 .. 40933130
3433 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG318000.1

Sequence Viewer

Length: 225 bp
ATGGCTGAATTTTTCTTTCATTCTAATGACAAGGGTGATGAACAACAGACAGTAGATGGCTTGATGCAACACCTCGGATTGGGAAAATATGCCATTATATTCAAGGCTGAGGAAATTGATATGACTGCATTGAAGCTAAGGGAGAAAATGACCTCAAAGAGCTGGGAATACCTATGGTTATTATTGAAGAAGAGTCGACTTCACCGTCAGTCCCGCTCAGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
SAM_1

Protein Analysis

74

Amino Acids

8.78

Weight (kDa)

8.05

Isoelectric Point (pI)

45.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 204
AccBSI CCGCTC 1 cut(s) 216
AccI GTMKAC 1 cut(s) 196
AciI CCGC 1 cut(s) 214
AcsI RAATTY 1 cut(s) 8
AfiI CCNNNNNNNGG 1 cut(s) 79
AgsI TTSAA 3 cut(s) 103, 133, 187
AluBI AGCT 2 cut(s) 136, 162
AluI AGCT 2 cut(s) 136, 162
ApoI RAATTY 1 cut(s) 8
AsuHPI GGTGA 2 cut(s) 47, 194
BbvCI CCTCAGC 1 cut(s) 108
BccI CCATC 1 cut(s) 50
BmsI GCATC 1 cut(s) 54
Bpu10I CCTNAGC 2 cut(s) 108, 137
BsaJI CCNNGG 1 cut(s) 73
Bsc4I CCNNNNNNNGG 1 cut(s) 79
BseDI CCNNGG 1 cut(s) 73
BseLI CCNNNNNNNGG 1 cut(s) 79
BseMII CTCAG 1 cut(s) 99
BseYI CCCAGC 1 cut(s) 162
BslFI GGGAC 1 cut(s) 196
BslI CCNNNNNNNGG 1 cut(s) 79
BsmFI GGGAC 1 cut(s) 196
BspACI CCGC 1 cut(s) 214
BspCNI CTCAG 1 cut(s) 100
BsrBI CCGCTC 1 cut(s) 216
BssECI CCNNGG 1 cut(s) 73
Bst4CI ACNGT 2 cut(s) 52, 206
Bst6I CTCTTC 1 cut(s) 185
BstDEI CTNAG 3 cut(s) 108, 137, 217
CviJI RGCY 5 cut(s) 5, 60, 107, 136, 162
CviKI_1 RGCY 5 cut(s) 5, 60, 107, 136, 162
DdeI CTNAG 3 cut(s) 108, 137, 217
DrdI GACNNNNNNGTC 1 cut(s) 204
DseDI GACNNNNNNGTC 1 cut(s) 204
Eam1104I CTCTTC 1 cut(s) 185
EarI CTCTTC 1 cut(s) 185
FaiI YATR 4 cut(s) 90, 98, 122, 175
FaqI GGGAC 1 cut(s) 196
FauI CCCGC 1 cut(s) 221
FblI GTMKAC 1 cut(s) 196
GsaI CCCAGC 1 cut(s) 166
HincII GTYRAC 1 cut(s) 197
HindII GTYRAC 1 cut(s) 197
HinfI GANTC 1 cut(s) 193
HphI GGTGA 2 cut(s) 47, 194
Hpy166II GTNNAC 1 cut(s) 197
Hpy188I TCNGA 2 cut(s) 77, 220
Hpy8I GTNNAC 1 cut(s) 197
HpyCH4III ACNGT 2 cut(s) 52, 206
HpyCH4V TGCA 2 cut(s) 67, 128
HpyF3I CTNAG 3 cut(s) 108, 137, 217
LpnPI CCDG 1 cut(s) 148
LweI GCATC 1 cut(s) 54
MbiI CCGCTC 1 cut(s) 216
MboII GAAGA 2 cut(s) 199, 202
MluCI AATT 2 cut(s) 8, 114
MlyI GAGTC 1 cut(s) 202
MnlI CCTC 3 cut(s) 83, 103, 163
MseI TTAA 1 cut(s) 223
MslI CAYNNNNRTG 1 cut(s) 24
PcsI WCGNNNNNNNCGW 1 cut(s) 202
PleI GAGTC 1 cut(s) 201
PpsI GAGTC 1 cut(s) 201
PspFI CCCAGC 1 cut(s) 162
RseI CAYNNNNRTG 1 cut(s) 24
SalI GTCGAC 1 cut(s) 195
SaqAI TTAA 1 cut(s) 223
SchI GAGTC 1 cut(s) 202
SetI ASST 5 cut(s) 75, 138, 155, 164, 174
SfaNI GCATC 1 cut(s) 54
SgeI CNNG 5 cut(s) 43, 73, 86, 115, 175
SmiMI CAYNNNNRTG 1 cut(s) 24
Sse9I AATT 2 cut(s) 8, 114
SsiI CCGC 1 cut(s) 214
TaaI ACNGT 2 cut(s) 52, 206
TaqI TCGA 1 cut(s) 196
TasI AATT 2 cut(s) 8, 114
Tru1I TTAA 1 cut(s) 223
Tru9I TTAA 1 cut(s) 223
TspDTI ATGAA 2 cut(s) 8, 54
XapI RAATTY 1 cut(s) 8
XmiI GTMKAC 1 cut(s) 196
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.