Rh5BG307900

SAM domain (Sterile alpha motif)

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
40166052 .. 40168333
2282 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG307900.1

Sequence Viewer

Length: 189 bp
ATGGCTGAATTTTTCTTTCATTCTAATGACAAGGGTGATGAACAACAGACAGTAGATGGCTTGATGCAACACCTCGGATTGGGAAAATATGCCATTATATTCAAGGCTGAGGAAATTGATATGACTGCATTGAAGCTAAGGGAGAAAATGACCTCAAAGAGCTGGGAATACCTATGGTGGAGGGTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

7.4

Weight (kDa)

5.55

Isoelectric Point (pI)

28.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 8
AfiI CCNNNNNNNGG 1 cut(s) 79
AgsI TTSAA 2 cut(s) 103, 133
AluBI AGCT 2 cut(s) 136, 162
AluI AGCT 2 cut(s) 136, 162
ApoI RAATTY 1 cut(s) 8
AsuHPI GGTGA 1 cut(s) 47
BbvCI CCTCAGC 1 cut(s) 108
BccI CCATC 1 cut(s) 50
BmsI GCATC 1 cut(s) 54
Bpu10I CCTNAGC 2 cut(s) 108, 137
BsaJI CCNNGG 1 cut(s) 73
Bsc4I CCNNNNNNNGG 1 cut(s) 79
BseDI CCNNGG 1 cut(s) 73
BseLI CCNNNNNNNGG 1 cut(s) 79
BseMII CTCAG 1 cut(s) 99
BseYI CCCAGC 1 cut(s) 162
BslI CCNNNNNNNGG 1 cut(s) 79
BspCNI CTCAG 1 cut(s) 100
BssECI CCNNGG 1 cut(s) 73
Bst4CI ACNGT 1 cut(s) 52
BstDEI CTNAG 2 cut(s) 108, 137
CviJI RGCY 5 cut(s) 5, 60, 107, 136, 162
CviKI_1 RGCY 5 cut(s) 5, 60, 107, 136, 162
DdeI CTNAG 2 cut(s) 108, 137
FaiI YATR 4 cut(s) 90, 98, 122, 175
GsaI CCCAGC 1 cut(s) 166
HphI GGTGA 1 cut(s) 47
Hpy188I TCNGA 1 cut(s) 77
HpyCH4III ACNGT 1 cut(s) 52
HpyCH4V TGCA 2 cut(s) 67, 128
HpyF3I CTNAG 2 cut(s) 108, 137
LpnPI CCDG 1 cut(s) 148
LweI GCATC 1 cut(s) 54
MluCI AATT 2 cut(s) 8, 114
MnlI CCTC 4 cut(s) 83, 103, 163, 174
MslI CAYNNNNRTG 1 cut(s) 24
PspFI CCCAGC 1 cut(s) 162
RseI CAYNNNNRTG 1 cut(s) 24
SetI ASST 5 cut(s) 75, 138, 155, 164, 174
SfaNI GCATC 1 cut(s) 54
SgeI CNNG 5 cut(s) 43, 73, 86, 115, 175
SmiMI CAYNNNNRTG 1 cut(s) 24
Sse9I AATT 2 cut(s) 8, 114
TaaI ACNGT 1 cut(s) 52
TasI AATT 2 cut(s) 8, 114
TspDTI ATGAA 2 cut(s) 8, 54
XapI RAATTY 1 cut(s) 8
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.