Rh2BG315400

SAM domain (Sterile alpha motif)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
OG0001403
Physical Location & Seq
Reverse (-)
37172074 .. 37184175
12102 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG315400.1

Sequence Viewer

Length: 279 bp
ATGAAAGGTAAAGCATTTTATCTACACAATTACAACCATGGTGATGAACAACAGACAGTAGATGGCTTGCTGCAACACCTCGGATTGGGAAAATATGCCATTATATTCAAGGCTGAGGAAATTGATATGACTGCATTGAAGCTAAGGGAGAAAATGACCTCAAAGAGCTGGGAATACCTATGGCTTCGAGCTTCTGTTCCAGCCATGAACTACCAAGTTGCAACCGGCAATCGAACAAGGCCAACAGTTCTCGAGAGAGCTGCTGGCCTACCCAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
SAM_1

Protein Analysis

92

Amino Acids

10.5

Weight (kDa)

9.3

Isoelectric Point (pI)

39.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 85
AgsI TTSAA 2 cut(s) 109, 139
AluBI AGCT 4 cut(s) 142, 168, 191, 260
AluI AGCT 4 cut(s) 142, 168, 191, 260
Ama87I CYCGRG 1 cut(s) 251
AoxI GGCC 2 cut(s) 239, 265
ApeKI GCWGC 2 cut(s) 70, 260
AsuHPI GGTGA 1 cut(s) 53
AvaI CYCGRG 1 cut(s) 251
BbvCI CCTCAGC 1 cut(s) 114
BbvI GCAGC 2 cut(s) 57, 247
BccI CCATC 1 cut(s) 56
BcgI CGANNNNNNTGC 2 cut(s) 242, 276
BisI GCNGC 2 cut(s) 71, 261
BlsI GCNGC 2 cut(s) 72, 262
BmeT110I CYCGRG 1 cut(s) 251
Bpu10I CCTNAGC 2 cut(s) 114, 143
BsaJI CCNNGG 2 cut(s) 37, 79
Bsc4I CCNNNNNNNGG 1 cut(s) 85
Bse118I RCCGGY 1 cut(s) 224
BseDI CCNNGG 2 cut(s) 37, 79
BseLI CCNNNNNNNGG 1 cut(s) 85
BseMII CTCAG 1 cut(s) 105
BseXI GCAGC 2 cut(s) 57, 247
BseYI CCCAGC 1 cut(s) 168
BshFI GGCC 2 cut(s) 241, 267
BsiHKCI CYCGRG 1 cut(s) 251
BsiSI CCGG 1 cut(s) 225
BslI CCNNNNNNNGG 1 cut(s) 85
BsnI GGCC 2 cut(s) 241, 267
BsoBI CYCGRG 1 cut(s) 251
Bsp19I CCATGG 1 cut(s) 37
BspANI GGCC 2 cut(s) 241, 267
BspCNI CTCAG 1 cut(s) 106
BsrFI RCCGGY 1 cut(s) 224
BssAI RCCGGY 1 cut(s) 224
BssECI CCNNGG 2 cut(s) 37, 79
BssT1I CCWWGG 1 cut(s) 37
Bst4CI ACNGT 2 cut(s) 58, 247
BstC8I GCNNGC 2 cut(s) 68, 265
BstDEI CTNAG 2 cut(s) 114, 143
BstDSI CCRYGG 1 cut(s) 37
BstV1I GCAGC 2 cut(s) 57, 247
BsuRI GGCC 2 cut(s) 241, 267
BtgI CCRYGG 1 cut(s) 37
Cac8I GCNNGC 2 cut(s) 68, 265
Cfr10I RCCGGY 1 cut(s) 224
CviAII CATG 2 cut(s) 38, 205
DdeI CTNAG 2 cut(s) 114, 143
Eco130I CCWWGG 1 cut(s) 37
Eco88I CYCGRG 1 cut(s) 251
EcoT14I CCWWGG 1 cut(s) 37
ErhI CCWWGG 1 cut(s) 37
FaeI CATG 2 cut(s) 41, 208
FaiI YATR 6 cut(s) 39, 96, 104, 128, 181, 206
FatI CATG 2 cut(s) 37, 204
Fnu4HI GCNGC 2 cut(s) 71, 261
Fsp4HI GCNGC 2 cut(s) 71, 261
GluI GCNGC 2 cut(s) 71, 261
GsaI CCCAGC 1 cut(s) 172
HaeIII GGCC 2 cut(s) 241, 267
HapII CCGG 1 cut(s) 225
Hin1II CATG 2 cut(s) 41, 208
HpaII CCGG 1 cut(s) 225
HphI GGTGA 1 cut(s) 53
Hpy188I TCNGA 1 cut(s) 83
Hpy188III TCNNGA 2 cut(s) 251, 253
HpyCH4III ACNGT 2 cut(s) 58, 247
HpyCH4V TGCA 3 cut(s) 73, 134, 221
HpyF3I CTNAG 2 cut(s) 114, 143
Hsp92II CATG 2 cut(s) 41, 208
LpnPI CCDG 4 cut(s) 154, 213, 238, 249
Lsp1109I GCAGC 2 cut(s) 57, 247
MluCI AATT 3 cut(s) 28, 120, 274
MnlI CCTC 3 cut(s) 89, 109, 169
MseI TTAA 1 cut(s) 277
MslI CAYNNNNRTG 1 cut(s) 42
MspI CCGG 1 cut(s) 225
NcoI CCATGG 1 cut(s) 37
NlaIII CATG 2 cut(s) 41, 208
PaeR7I CTCGAG 1 cut(s) 251
PkrI GCNGC 2 cut(s) 72, 262
PspFI CCCAGC 1 cut(s) 168
RseI CAYNNNNRTG 1 cut(s) 42
SaqAI TTAA 1 cut(s) 277
SatI GCNGC 2 cut(s) 71, 261
SetI ASST 8 cut(s) 10, 81, 144, 161, 170, 180, 193, 262
Sfr274I CTCGAG 1 cut(s) 251
SlaI CTCGAG 1 cut(s) 251
SmiMI CAYNNNNRTG 1 cut(s) 42
SmlI CTYRAG 1 cut(s) 251
SmoI CTYRAG 1 cut(s) 251
Sse9I AATT 3 cut(s) 28, 120, 274
StyI CCWWGG 1 cut(s) 37
TaaI ACNGT 2 cut(s) 58, 247
TaqI TCGA 3 cut(s) 187, 232, 252
TasI AATT 3 cut(s) 28, 120, 274
Tru1I TTAA 1 cut(s) 277
Tru9I TTAA 1 cut(s) 277
TseI GCWGC 2 cut(s) 70, 260
TspDTI ATGAA 3 cut(s) 17, 60, 221
XhoI CTCGAG 1 cut(s) 251
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.