Rh1BG312100

SWI SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 3-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Reverse (-)
44633051 .. 44640350
7300 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG312100.1

Sequence Viewer

Length: 348 bp
ATGCAAAAGGTTCTCAAGAACTTCAAGGTTCCGAGAATACAGAAAGAGTTTATAGAAGAGGCAACCCATCCACCGGAAAAACGACCAGAGCCTCTAAATGGTGGGATCTTTGCAGATGATATGGCTTTAGGTAAGACTCTGACTTTGGCTTCCTCGATTGCTTTTGTTAAATACGGTAGTAGCGATGGCAACAGTGCTAGTGTAGATGAAAGCATACCGTATGATAATGAAATGGGTGAGGATAGCAGTGAAAAGGAAGAATTTGTGAGTGTAACTGATAAGGGTCACCAAAATTGGGGTAAAGATCGATCAGGAAATATGATGCTTGATTTGGCGTACGCATCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

115

Amino Acids

12.7

Weight (kDa)

4.76

Isoelectric Point (pI)

33.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 113
AcsI RAATTY 1 cut(s) 260
AfaI GTAC 1 cut(s) 338
AfiI CCNNNNNNNGG 3 cut(s) 73, 98, 295
AgsI TTSAA 1 cut(s) 25
AlwI GGATC 1 cut(s) 113
ApoI RAATTY 1 cut(s) 260
ArsI GACNNNNNNTTYG 2 cut(s) 127, 159
AsuHPI GGTGA 2 cut(s) 248, 278
BccI CCATC 2 cut(s) 75, 179
BfaI CTAG 1 cut(s) 198
BmiI GGNNCC 1 cut(s) 30
BmsI GCATC 1 cut(s) 312
Bsa29I ATCGAT 1 cut(s) 307
BsaWI WCCGGW 1 cut(s) 73
Bsc4I CCNNNNNNNGG 3 cut(s) 73, 98, 295
BseCI ATCGAT 1 cut(s) 307
BseGI GGATG 1 cut(s) 67
BseLI CCNNNNNNNGG 3 cut(s) 73, 98, 295
BshVI ATCGAT 1 cut(s) 307
BsiSI CCGG 1 cut(s) 74
BsiWI CGTACG 1 cut(s) 336
BslI CCNNNNNNNGG 3 cut(s) 73, 98, 295
Bsp143I GATC 3 cut(s) 105, 304, 308
BspDI ATCGAT 1 cut(s) 307
BspLI GGNNCC 1 cut(s) 30
BspPI GGATC 1 cut(s) 113
BssMI GATC 3 cut(s) 105, 304, 308
Bst4CI ACNGT 3 cut(s) 176, 194, 219
Bst6I CTCTTC 1 cut(s) 51
BstEII GGTNACC 1 cut(s) 284
BstF5I GGATG 1 cut(s) 67
BstKTI GATC 3 cut(s) 108, 307, 311
BstMBI GATC 3 cut(s) 105, 304, 308
BstPI GGTNACC 1 cut(s) 284
BstX2I RGATCY 1 cut(s) 105
BstYI RGATCY 1 cut(s) 105
Bsu15I ATCGAT 1 cut(s) 307
BsuTUI ATCGAT 1 cut(s) 307
BtgZI GCGATG 1 cut(s) 198
BtsCI GGATG 1 cut(s) 67
BtsI GCAGTG 1 cut(s) 253
BtsIMutI CAGTG 2 cut(s) 199, 253
ClaI ATCGAT 1 cut(s) 307
Csp6I GTAC 1 cut(s) 337
CviJI RGCY 3 cut(s) 91, 125, 149
CviKI_1 RGCY 3 cut(s) 91, 125, 149
CviQI GTAC 1 cut(s) 337
DpnI GATC 3 cut(s) 107, 306, 310
DpnII GATC 3 cut(s) 105, 304, 308
Eam1104I CTCTTC 1 cut(s) 51
EarI CTCTTC 1 cut(s) 51
Eco91I GGTNACC 1 cut(s) 284
EcoO65I GGTNACC 1 cut(s) 284
FaiI YATR 5 cut(s) 53, 122, 215, 222, 320
FokI GGATG 1 cut(s) 54
FspBI CTAG 1 cut(s) 198
HapII CCGG 1 cut(s) 74
HinfI GANTC 1 cut(s) 136
HpaII CCGG 1 cut(s) 74
HphI GGTGA 2 cut(s) 248, 278
Hpy188I TCNGA 2 cut(s) 33, 141
Hpy188III TCNNGA 2 cut(s) 16, 312
HpyCH4III ACNGT 3 cut(s) 176, 194, 219
HpyCH4V TGCA 2 cut(s) 4, 113
Kzo9I GATC 3 cut(s) 105, 304, 308
LpnPI CCDG 3 cut(s) 87, 99, 297
LweI GCATC 1 cut(s) 312
MaeI CTAG 1 cut(s) 198
MaeIII GTNAC 2 cut(s) 271, 284
MalI GATC 3 cut(s) 107, 306, 310
MboI GATC 3 cut(s) 105, 304, 308
MboII GAAGA 2 cut(s) 68, 269
MflI RGATCY 1 cut(s) 105
MluCI AATT 2 cut(s) 260, 292
MlyI GAGTC 1 cut(s) 130
MnlI CCTC 4 cut(s) 52, 102, 163, 232
MseI TTAA 2 cut(s) 168, 346
MspI CCGG 1 cut(s) 74
NdeII GATC 3 cut(s) 105, 304, 308
NlaIV GGNNCC 1 cut(s) 30
NmuCI GTSAC 1 cut(s) 284
PcsI WCGNNNNNNNCGW 1 cut(s) 180
Pfl23II CGTACG 1 cut(s) 336
PleI GAGTC 1 cut(s) 130
PpsI GAGTC 1 cut(s) 130
PspEI GGTNACC 1 cut(s) 284
PspLI CGTACG 1 cut(s) 336
PspN4I GGNNCC 1 cut(s) 30
PsuI RGATCY 1 cut(s) 105
RsaI GTAC 1 cut(s) 338
RsaNI GTAC 1 cut(s) 337
SaqAI TTAA 2 cut(s) 168, 346
Sau3AI GATC 3 cut(s) 105, 304, 308
SchI GAGTC 1 cut(s) 130
SetI ASST 3 cut(s) 12, 30, 133
SfaNI GCATC 1 cut(s) 312
SgeI CNNG 9 cut(s) 28, 37, 45, 86, 98, 166, 210, 324, 338
SmlI CTYRAG 1 cut(s) 14
SmoI CTYRAG 1 cut(s) 14
Sse9I AATT 2 cut(s) 260, 292
SspMI CTAG 1 cut(s) 198
TaaI ACNGT 3 cut(s) 176, 194, 219
TaqI TCGA 2 cut(s) 155, 307
TasI AATT 2 cut(s) 260, 292
Tru1I TTAA 2 cut(s) 168, 346
Tru9I TTAA 2 cut(s) 168, 346
TscAI CASTG 2 cut(s) 199, 253
TseFI GTSAC 1 cut(s) 284
Tsp45I GTSAC 1 cut(s) 284
TspDTI ATGAA 2 cut(s) 222, 243
TspRI CASTG 2 cut(s) 199, 253
XapI RAATTY 1 cut(s) 260
XspI CTAG 1 cut(s) 198
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.