Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr3B

Orthogroup ID

OG0003456

Physical Location & Seq

Genomic Coordinates Reverse (-)

47865730 .. 47865921

Gene Structure 192 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh3BG375900.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 192 bp

ATGGCTTTGGGTAATACTTTGACTTTGCTTTCCTTTATTGCTTTTGTTAAATATAGTAGTGGCAATGGCAACAGTGCTAGTGCTAGTGTAGATGAAAGCATACCATATGATAATGAAATGGGTGAGGATAGCAGTGAGAAGGAAGAATCTGTGAGTGTAACTGATAAGGTCACCAAAATTGGGGTCAAGTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

HIRAN Helicase_C SNF2_N zf-C3HC4 zf-C3HC4_3

Protein Analysis

63

Amino Acids

6.65

Weight (kDa)

4.32

Isoelectric Point (pI)

22.67

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003456)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g23542
rosa_chinensis	RchiOBHm_Chr1g0323881 RchiOBHm_Chr1g0363301 RchiOBHm_Chr3g0488451 RchiOBHm_Chr4g0387101 RchiOBHm_Chr4g0387111 RchiOBHm_Chr4g0402531
rosa_laevigata	RLG00000000633 RLG00000003072 RLG00000011416 RLG00000019029 RLG00000026076 RLG00000036164
rosa_multiflora	Rmu_co8181938.1_g000002 Rmu_co8182286.1_g000002 Rmu_sc0000103.1_g000012 Rmu_sc0001207.1_g000051 Rmu_sc0003615.1_g000003 Rmu_sc0004695.1_g000012 Rmu_sc0006098.1_g000005 Rmu_sc0007104.1_g000004 Rmu_sc0022560.1_g000001
rosa_roxburghii	Rroxscaffold_3G00249830 Rroxscaffold_3G00250680 Rroxscaffold_4G00290730 Rroxscaffold_4G00291010 Rroxscaffold_5G00369410 Rroxscaffold_7G00179280
rosa_rugosa	Rorug07G0054300
rosa_samantha	Rh1BG312100 Rh1CG327200 Rh1DG343700 Rh3BG375900 Rh5BG126700 Rh7AG071200 Rh7DG076500

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfiI	CCNNNNNNNGG	1 cut(s)	180
ArsI	GACNNNNNNTTYG	1 cut(s)	168
AsuHPI	GGTGA	2 cut(s)	134, 163
BfaI	CTAG	2 cut(s)	78, 84
Bsc4I	CCNNNNNNNGG	1 cut(s)	180
Bse3DI	GCAATG	1 cut(s)	70
BseLI	CCNNNNNNNGG	1 cut(s)	180
BseMI	GCAATG	1 cut(s)	70
BslI	CCNNNNNNNGG	1 cut(s)	180
BsrDI	GCAATG	1 cut(s)	70
Bst4CI	ACNGT	1 cut(s)	74
BstEII	GGTNACC	1 cut(s)	169
BstPI	GGTNACC	1 cut(s)	169
BtsI	GCAGTG	1 cut(s)	139
BtsIMutI	CAGTG	2 cut(s)	79, 139
CviJI	RGCY	1 cut(s)	5
CviKI_1	RGCY	1 cut(s)	5
Eco91I	GGTNACC	1 cut(s)	169
EcoO65I	GGTNACC	1 cut(s)	169
FaiI	YATR	4 cut(s)	54, 101, 106, 108
FauNDI	CATATG	1 cut(s)	106
FspBI	CTAG	2 cut(s)	78, 84
HinfI	GANTC	1 cut(s)	146
HphI	GGTGA	2 cut(s)	134, 163
HpyAV	CCTTC	1 cut(s)	133
HpyCH4III	ACNGT	1 cut(s)	74
MaeI	CTAG	2 cut(s)	78, 84
MaeIII	GTNAC	2 cut(s)	157, 169
MboII	GAAGA	1 cut(s)	155
MluCI	AATT	1 cut(s)	177
MnlI	CCTC	1 cut(s)	118
MseI	TTAA	1 cut(s)	48
NdeI	CATATG	1 cut(s)	106
NmuCI	GTSAC	1 cut(s)	169
PfeI	GAWTC	1 cut(s)	146
PspEI	GGTNACC	1 cut(s)	169
SaqAI	TTAA	1 cut(s)	48
SetI	ASST	1 cut(s)	171
SgeI	CNNG	2 cut(s)	90, 96
Sse9I	AATT	1 cut(s)	177
SspMI	CTAG	2 cut(s)	78, 84
TaaI	ACNGT	1 cut(s)	74
TasI	AATT	1 cut(s)	177
TfiI	GAWTC	1 cut(s)	146
Tru1I	TTAA	1 cut(s)	48
Tru9I	TTAA	1 cut(s)	48
TscAI	CASTG	2 cut(s)	79, 139
TseFI	GTSAC	1 cut(s)	169
Tsp45I	GTSAC	1 cut(s)	169
TspDTI	ATGAA	2 cut(s)	108, 129
TspRI	CASTG	2 cut(s)	79, 139
XspI	CTAG	2 cut(s)	78, 84

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.