Rw3G002550

phosphatase 2C

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr3
Physical Location & Seq
Forward (+)
2242486 .. 2243322
837 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw3G002550.1

Sequence Viewer

Length: 228 bp
ATGTGGTCTCACTTCGACTTTAGTGGTCCAACTTCTGGGAGCACAGCTTGTGTTGCAATTATTAGAAACAACCAACTTGTTGTTGCCAATGCTGGTGATTCTCGTTGTGTCATATTGAGGAAGGGTCAGATAGGAGATCAAAGATGTGCTAAATTCACACTCCATTTTGTCCAGCTTAGGGAAAGGGTGATGCTACAACTTAAGCTTGGCAAAATCACTGCTACTTGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

75

Amino Acids

8.31

Weight (kDa)

10.07

Isoelectric Point (pI)

23.76

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PP2C PF00481 11 - 45 1.7e-10 Protein phosphatase 2C
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 35
AcsI RAATTY 1 cut(s) 152
AfiI CCNNNNNNNGG 2 cut(s) 35, 178
AflII CTTAAG 1 cut(s) 200
AluBI AGCT 3 cut(s) 47, 175, 205
AluI AGCT 3 cut(s) 47, 175, 205
Alw21I GWGCWC 1 cut(s) 44
Alw26I GTCTC 1 cut(s) 12
ApoI RAATTY 1 cut(s) 152
AspS9I GGNCC 1 cut(s) 26
AsuHPI GGTGA 2 cut(s) 107, 199
AvaII GGWCC 1 cut(s) 26
Bbv12I GWGCWC 1 cut(s) 44
BcoDI GTCTC 1 cut(s) 12
BfrI CTTAAG 1 cut(s) 200
Bme18I GGWCC 1 cut(s) 26
BmgT120I GGNCC 1 cut(s) 26
BmsI GCATC 1 cut(s) 180
Bpu10I CCTNAGC 1 cut(s) 176
BsaI GGTCTC 1 cut(s) 12
Bsc4I CCNNNNNNNGG 2 cut(s) 35, 178
BseLI CCNNNNNNNGG 2 cut(s) 35, 178
BsiHKAI GWGCWC 1 cut(s) 44
BslI CCNNNNNNNGG 2 cut(s) 35, 178
BsmAI GTCTC 1 cut(s) 12
Bso31I GGTCTC 1 cut(s) 12
Bsp1286I GDGCHC 1 cut(s) 44
Bsp143I GATC 1 cut(s) 136
BspTI CTTAAG 1 cut(s) 200
BspTNI GGTCTC 1 cut(s) 12
BssMI GATC 1 cut(s) 136
BstAFI CTTAAG 1 cut(s) 200
BstDEI CTNAG 1 cut(s) 176
BstKTI GATC 1 cut(s) 139
BstMAI GTCTC 1 cut(s) 12
BstMBI GATC 1 cut(s) 136
BstMWI GCNNNNNNNGC 1 cut(s) 53
BtsI GCAGTG 1 cut(s) 216
BtsIMutI CAGTG 1 cut(s) 216
Cfr13I GGNCC 1 cut(s) 26
CviJI RGCY 3 cut(s) 47, 175, 205
CviKI_1 RGCY 3 cut(s) 47, 175, 205
DdeI CTNAG 1 cut(s) 176
DpnI GATC 1 cut(s) 138
DpnII GATC 1 cut(s) 136
Eco31I GGTCTC 1 cut(s) 12
Eco47I GGWCC 1 cut(s) 26
FaiI YATR 1 cut(s) 113
HindIII AAGCTT 1 cut(s) 203
HinfI GANTC 1 cut(s) 98
HphI GGTGA 2 cut(s) 107, 199
Hpy188I TCNGA 1 cut(s) 129
HpyAV CCTTC 1 cut(s) 115
HpyCH4V TGCA 1 cut(s) 56
HpyF10VI GCNNNNNNNGC 1 cut(s) 53
HpyF3I CTNAG 1 cut(s) 176
Kzo9I GATC 1 cut(s) 136
LmnI GCTCC 1 cut(s) 39
LpnPI CCDG 3 cut(s) 21, 78, 185
LweI GCATC 1 cut(s) 180
MalI GATC 1 cut(s) 138
MboI GATC 1 cut(s) 136
MhlI GDGCHC 1 cut(s) 44
MluCI AATT 2 cut(s) 57, 152
MmeI TCCRAC 1 cut(s) 53
MnlI CCTC 1 cut(s) 111
MseI TTAA 1 cut(s) 201
MspCI CTTAAG 1 cut(s) 200
MwoI GCNNNNNNNGC 1 cut(s) 53
NdeII GATC 1 cut(s) 136
PfeI GAWTC 1 cut(s) 98
PflMI CCANNNNNTGG 1 cut(s) 35
PspPI GGNCC 1 cut(s) 26
SaqAI TTAA 1 cut(s) 201
Sau3AI GATC 1 cut(s) 136
Sau96I GGNCC 1 cut(s) 26
SduI GDGCHC 1 cut(s) 44
SetI ASST 3 cut(s) 49, 177, 207
SfaNI GCATC 1 cut(s) 180
SgeI CNNG 7 cut(s) 48, 60, 89, 105, 114, 184, 218
SinI GGWCC 1 cut(s) 26
SmlI CTYRAG 1 cut(s) 200
SmoI CTYRAG 1 cut(s) 200
Sse9I AATT 2 cut(s) 57, 152
TaqI TCGA 1 cut(s) 15
TasI AATT 2 cut(s) 57, 152
TfiI GAWTC 1 cut(s) 98
Tru1I TTAA 1 cut(s) 201
Tru9I TTAA 1 cut(s) 201
TscAI CASTG 1 cut(s) 223
TspRI CASTG 1 cut(s) 223
Van91I CCANNNNNTGG 1 cut(s) 35
Vha464I CTTAAG 1 cut(s) 200
VpaK11BI GGWCC 1 cut(s) 26
XapI RAATTY 1 cut(s) 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.