MD07G1008400.v1.1

Belongs to the disease resistance NB-LRR family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
OG0000725
Physical Location & Seq
Reverse (-)
791381 .. 792491
1111 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1008400.v1.1.491

Sequence Viewer

Length: 996 bp
ATGGTGCCTGAAAGTACTAAAGTGTCAAAGAAGGTACGCCTCTTATTTTCTAGCTCAAATCAACTTACTTTTGGGCTAAAGATGGGCCAGAAGAAAAAAAATATTAACAAAAGGTTTCGTGCGATTGCATTTGGTAGAACCTTTCACTTAGAATTAAATCGTGAAGAGCCACGATTTATAATTAGAGAAAGGGTCACTCACTCTTTTGTCCCCAAGGAAAATATTATTGGGAGATATGAAGATAAAATGGCAATTATTCAACTTTTGTTGGATCCCATCTCAACTGAGAATGTGTCAACCATTTCCATAGTTGGATTTGGAGGATTGGGAAAAACTGCACTTGCCCAACTCATATTCAACAATGAGTTGCAAAATGATCTTAGGAGAAAAGTAGATGGGAAGAAGTACCTACTTGTGTTGGATGATGTGTGGAATGAGAATCGAGAGAAATGGCTTAGCTTGAAGTACTTGTTAATGGGTGGCGGAAAAGGTAGTAGAATACTAATAACCACTTGTAGTGAAATCATTGCAACGGTATCAAACACAGCTAAACCATACACCTTAAGGGGTTTGAATGAAGAGCAAAGTTGGTCTTTATTTAAGGAAATGGCCCTTAAAGATGGAAAAGAGCTAGAAAATTCAACAATTAAGGCAGTTGGGAAGGAGATTGCAAGAAAATGTCAGGGAGTTCCACTTGCTATAAGGACGATAGGTCGGATGTTGCACACCAAACATCACGAAACAGAATGGTTGAATTTCAAAGAAAAAAAACTTTCAAAAATAAGTCAAGAAGAAAATGATATTTTACCAACACTTAAACTAAGTTATGATGTGCTTCCATCACATTTGAAGCATTGTTTTGCTTTTTGTCGCTTGTTCCCACCTGATTATGAGATCTCTGTACATAAATTGATTAAACTTTGGGTGGCACAAGGGTTTATTAAGTCTTTAGATGAAAATGAGTGTTTGGAAGATGTTGCGTATGAATACTACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04014 map04014
Pfam Domains
Protein Families
LRR_8 NB-ARC

Protein Analysis

332

Amino Acids

38.12

Weight (kDa)

9.33

Isoelectric Point (pI)

35.77

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NB-ARC PF00931 121 - 206 1.2e-13 NB-ARC domain
WHD_DRP PF23559 292 - 330 6.1e-10 Disease resistance protein Winged helix domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000725)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g16700
malus_domestica MD02G1307600.v1.1 MD03G1278800.v1.1 MD03G1279100.v1.1 MD03G1279600.v1.1 MD03G1280000.v1.1 MD03G1280200.v1.1 MD07G1008400.v1.1 MD07G1014900.v1.1 MD07G1015700.v1.1 MD07G1016100.v1.1 MD07G1016200.v1.1 MD07G1016500.v1.1 MD07G1016600.v1.1 MD07G1016700.v1.1 MD07G1017400.v1.1 MD07G1019600.v1.1 MD07G1019800.v1.1 MD07G1023700.v1.1 MD07G1024100.v1.1 MD07G1024300.v1.1 MD07G1024400.v1.1 MD14G1086900.v1.1 MD14G1087000.v1.1 MD16G1179200.v1.1 MD17G1030800.v1.1
prunus_persica Prupe.2G011000_v2.0.a1 Prupe.2G011000_v2.0.a1 Prupe.2G011000_v2.0.a1 Prupe.2G011000_v2.0.a1 Prupe.2G011000_v2.0.a1 Prupe.2G011000_v2.0.a1 Prupe.2G011400_v2.0.a1 Prupe.2G011500_v2.0.a1 Prupe.2G013800_v2.0.a1 Prupe.2G013800_v2.0.a1 Prupe.2G013800_v2.0.a1 Prupe.2G013900_v2.0.a1 Prupe.2G013900_v2.0.a1 Prupe.2G013900_v2.0.a1 Prupe.2G013900_v2.0.a1 Prupe.2G014000_v2.0.a1 Prupe.2G014100_v2.0.a1
pyrus_communis pycom02g25880 pycom07g00690 pycom07g00720 pycom07g01130 pycom07g01140 pycom07g01150 pycom07g01160 pycom07g01260 pycom07g01280 pycom07g01300 pycom07g01320 pycom07g01550 pycom07g01790 pycom07g01810 pycom07g01840 pycom07g01850 pycom07g01870 pycom07g01880 pycom07g01890 pycom13g15290 pycom16g15040
rosa_chinensis RchiOBHm_Chr4g0420141
rosa_multiflora Rmu_sc0001252.1_g000002
rosa_roxburghii Rroxscaffold_1G00012760
rosa_rugosa Rorug04G0162600
rosa_samantha Rh4AG223400 Rh4BG225900 Rh4CG236600 Rh4DG222200
rosa_wichuraiana Rw4G019230

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 179
AccB1I GGYRCC 1 cut(s) 4
AciI CCGC 1 cut(s) 483
AclWI GGATC 2 cut(s) 266, 279
AcsI RAATTY 2 cut(s) 637, 754
AfaI GTAC 5 cut(s) 16, 36, 407, 467, 903
AflII CTTAAG 1 cut(s) 562
AgsI TTSAA 9 cut(s) 260, 358, 463, 574, 642, 754, 760, 777, 850
AhdI GACNNNNNGTC 1 cut(s) 711
AjuI GAANNNNNNNTTGG 2 cut(s) 210, 242
AluBI AGCT 4 cut(s) 54, 459, 548, 631
AluI AGCT 4 cut(s) 54, 459, 548, 631
AlwI GGATC 2 cut(s) 266, 279
AoxI GGCC 2 cut(s) 85, 609
ApoI RAATTY 2 cut(s) 637, 754
AspS9I GGNCC 2 cut(s) 85, 610
BamHI GGATCC 1 cut(s) 271
BanI GGYRCC 1 cut(s) 4
BccI CCATC 5 cut(s) 76, 284, 389, 614, 847
BfaI CTAG 3 cut(s) 51, 632, 994
BfrI CTTAAG 1 cut(s) 562
BglII AGATCT 1 cut(s) 894
BlpI GCTNAGC 1 cut(s) 455
BmcAI AGTACT 2 cut(s) 16, 467
BmeRI GACNNNNNGTC 1 cut(s) 711
BmgT120I GGNCC 2 cut(s) 85, 610
BmiI GGNNCC 2 cut(s) 6, 273
Bpu1102I GCTNAGC 1 cut(s) 455
BsaJI CCNNGG 1 cut(s) 213
Bse3DI GCAATG 1 cut(s) 525
BseDI CCNNGG 1 cut(s) 213
BseGI GGATG 2 cut(s) 427, 723
BseMI GCAATG 1 cut(s) 525
BseMII CTCAG 1 cut(s) 276
BsgI GTGCAG 1 cut(s) 321
BshFI GGCC 2 cut(s) 87, 611
BshNI GGYRCC 1 cut(s) 4
BslFI GGGAC 1 cut(s) 194
BsmFI GGGAC 1 cut(s) 194
BsnI GGCC 2 cut(s) 87, 611
Bsp1407I TGTACA 1 cut(s) 901
Bsp143I GATC 3 cut(s) 271, 376, 894
Bsp1720I GCTNAGC 1 cut(s) 455
BspACI CCGC 1 cut(s) 483
BspANI GGCC 2 cut(s) 87, 611
BspCNI CTCAG 1 cut(s) 277
BspLI GGNNCC 2 cut(s) 6, 273
BspPI GGATC 2 cut(s) 266, 279
BspQI GCTCTTC 2 cut(s) 159, 573
BspT107I GGYRCC 1 cut(s) 4
BspTI CTTAAG 1 cut(s) 562
BsrDI GCAATG 1 cut(s) 525
BsrGI TGTACA 1 cut(s) 901
BssECI CCNNGG 1 cut(s) 213
BssMI GATC 3 cut(s) 271, 376, 894
BssT1I CCWWGG 1 cut(s) 213
Bst4CI ACNGT 1 cut(s) 535
Bst6I CTCTTC 2 cut(s) 159, 573
BstAFI CTTAAG 1 cut(s) 562
BstAUI TGTACA 1 cut(s) 901
BstDEI CTNAG 5 cut(s) 148, 285, 380, 455, 821
BstF5I GGATG 2 cut(s) 427, 723
BstKTI GATC 3 cut(s) 274, 379, 897
BstMBI GATC 3 cut(s) 271, 376, 894
BstX2I RGATCY 2 cut(s) 271, 894
BstYI RGATCY 2 cut(s) 271, 894
BsuRI GGCC 2 cut(s) 87, 611
BtsCI GGATG 2 cut(s) 427, 723
Cfr13I GGNCC 2 cut(s) 85, 610
Csp6I GTAC 5 cut(s) 15, 35, 406, 466, 902
CviJI RGCY 9 cut(s) 54, 76, 87, 169, 454, 459, 548, 611, 631
CviKI_1 RGCY 9 cut(s) 54, 76, 87, 169, 454, 459, 548, 611, 631
CviQI GTAC 5 cut(s) 15, 35, 406, 466, 902
DdeI CTNAG 5 cut(s) 148, 285, 380, 455, 821
DpnI GATC 3 cut(s) 273, 378, 896
DpnII GATC 3 cut(s) 271, 376, 894
DriI GACNNNNNGTC 1 cut(s) 711
Eam1104I CTCTTC 2 cut(s) 159, 573
Eam1105I GACNNNNNGTC 1 cut(s) 711
EarI CTCTTC 2 cut(s) 159, 573
EciI GGCGGA 1 cut(s) 498
Eco130I CCWWGG 1 cut(s) 213
EcoT14I CCWWGG 1 cut(s) 213
ErhI CCWWGG 1 cut(s) 213
FalI AAGNNNNNCTT 2 cut(s) 577, 609
FaqI GGGAC 1 cut(s) 194
FokI GGATG 2 cut(s) 434, 730
FspBI CTAG 3 cut(s) 51, 632, 994
HaeIII GGCC 2 cut(s) 87, 611
HincII GTYRAC 1 cut(s) 297
HindII GTYRAC 1 cut(s) 297
HinfI GANTC 1 cut(s) 439
Hpy166II GTNNAC 1 cut(s) 297
Hpy188I TCNGA 1 cut(s) 717
Hpy188III TCNNGA 4 cut(s) 161, 443, 737, 788
Hpy8I GTNNAC 1 cut(s) 297
HpyAV CCTTC 2 cut(s) 25, 655
HpyCH4III ACNGT 1 cut(s) 535
HpyCH4V TGCA 6 cut(s) 128, 338, 370, 530, 671, 724
HpyF3I CTNAG 5 cut(s) 148, 285, 380, 455, 821
Kzo9I GATC 3 cut(s) 271, 376, 894
LguI GCTCTTC 2 cut(s) 159, 573
LpnPI CCDG 4 cut(s) 21, 101, 668, 897
MaeI CTAG 3 cut(s) 51, 632, 994
MaeIII GTNAC 1 cut(s) 193
MalI GATC 3 cut(s) 273, 378, 896
MboI GATC 3 cut(s) 271, 376, 894
MboII GAAGA 7 cut(s) 103, 176, 251, 412, 590, 803, 983
MflI RGATCY 2 cut(s) 271, 894
MluCI AATT 7 cut(s) 152, 180, 252, 637, 645, 754, 908
MmeI TCCRAC 4 cut(s) 249, 292, 399, 695
MnlI CCTC 2 cut(s) 50, 314
MspCI CTTAAG 1 cut(s) 562
NdeII GATC 3 cut(s) 271, 376, 894
NlaIV GGNNCC 2 cut(s) 6, 273
NmuCI GTSAC 1 cut(s) 193
PciSI GCTCTTC 2 cut(s) 159, 573
PfeI GAWTC 1 cut(s) 439
PsiI TTATAA 1 cut(s) 179
PspN4I GGNNCC 2 cut(s) 6, 273
PspPI GGNCC 2 cut(s) 85, 610
PsuI RGATCY 2 cut(s) 271, 894
RsaI GTAC 5 cut(s) 16, 36, 407, 467, 903
RsaNI GTAC 5 cut(s) 15, 35, 406, 466, 902
SapI GCTCTTC 2 cut(s) 159, 573
Sau3AI GATC 3 cut(s) 271, 376, 894
Sau96I GGNCC 2 cut(s) 85, 610
ScaI AGTACT 2 cut(s) 16, 467
SmlI CTYRAG 1 cut(s) 562
SmoI CTYRAG 1 cut(s) 562
Sse9I AATT 7 cut(s) 152, 180, 252, 637, 645, 754, 908
SsiI CCGC 1 cut(s) 483
SspI AATATT 2 cut(s) 103, 223
SspMI CTAG 3 cut(s) 51, 632, 994
StyI CCWWGG 1 cut(s) 213
TaaI ACNGT 1 cut(s) 535
TaqI TCGA 1 cut(s) 442
TasI AATT 7 cut(s) 152, 180, 252, 637, 645, 754, 908
TatI WGTACW 3 cut(s) 14, 465, 901
TfiI GAWTC 1 cut(s) 439
TseFI GTSAC 1 cut(s) 193
Tsp45I GTSAC 1 cut(s) 193
TspDTI ATGAA 3 cut(s) 252, 591, 969
Vha464I CTTAAG 1 cut(s) 562
XapI RAATTY 2 cut(s) 637, 754
XspI CTAG 3 cut(s) 51, 632, 994
ZrmI AGTACT 2 cut(s) 16, 467
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.