MD07G1016700.v1.1

Belongs to the disease resistance NB-LRR family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
OG0000725
Physical Location & Seq
Forward (+)
1462972 .. 1464224
1253 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1016700.v1.1.491

Sequence Viewer

Length: 918 bp
ATGGCTTTTAAAGATGGAGAAGAACCAGAGAATTCAACAATTAAGGCAGTTGGGATGGAGGTTGTAAGAAAATGTCAGGGAGTTCCACTCGCTCTAAGGACGATAGGTGGGATGTTGCGCACCAAACATCATGAAATAGAATGGCTTAATTTCAAAGAAAGGAAACTTTCAAAAATAAGTCAAAAAGAAGATGATATTTTACCAACACTTAAACTAAGTTATGATGTGCTCCCATCACATTTGAAGCATTGTTTTGCTTATTGTAGCTTGTTCCCACCTGATTATGATATCTCTGTACCAAGATTGATTAGACTTTGGGTGGCCCAAGGGTTCGTTAAGTCATCCGACGAAATCGAGTGTTTGGAGGATGTTGCGTTTGAATATTATAGGGAATTGTTGTGCAGATCGTTTTTTCAAGAAGAAAAAACAAATGAGTTTGGTATAATAGAAAGTTGTAAAATGCACGATCTCATGAATGAACTTGCAATCTTAGTGTCGGGTGTCAGGAGCGTCGTAGTTGATCTGAACCGAAAGAACTTTCATGAAAAGCTTCGTCACGTATCTTTCAATTTTGATATTGATTTGTTGAAATGGGAAGTGCCAACTTCCTTGGTAAAAGCATGCAAGATACGAACTTATCTTTTTCTTTGCCAAGAGGTTTTGAAAGATTACGATGAGTCATTATGTGATTCATTTTGTACCACAATTGTTTCAAATTTTAAGTCATTACGGATGTTGAGTCTCAATACAATATATATTATAAGATTGCCTAATTGTTTTAAAAAAATGAAACATTTGAGATATCTTGATCTTAGTGGGAATCTCATGATGGAGAGACTTCCAGATTGGATAGTTGGACTTTCGAATTTGGAAACACTAGATCTCATTGGAATGCCACGTGACGAATGGAATTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04014 map04014
Pfam Domains
Protein Families
LRR_8 NB-ARC

Protein Analysis

306

Amino Acids

35.71

Weight (kDa)

6.11

Isoelectric Point (pI)

41.92

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
WHD_DRP PF23559 90 - 162 4.4e-23 Disease resistance protein Winged helix domain
LRR_14 PF23598 237 - 296 1.1e-06 Leucine-rich repeat region
LRR_8 PF13855 257 - 295 1.3e-06 Leucine rich repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000725)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g16700
malus_domestica MD02G1307600.v1.1 MD03G1278800.v1.1 MD03G1279100.v1.1 MD03G1279600.v1.1 MD03G1280000.v1.1 MD03G1280200.v1.1 MD07G1008400.v1.1 MD07G1014900.v1.1 MD07G1015700.v1.1 MD07G1016100.v1.1 MD07G1016200.v1.1 MD07G1016500.v1.1 MD07G1016600.v1.1 MD07G1016700.v1.1 MD07G1017400.v1.1 MD07G1019600.v1.1 MD07G1019800.v1.1 MD07G1023700.v1.1 MD07G1024100.v1.1 MD07G1024300.v1.1 MD07G1024400.v1.1 MD14G1086900.v1.1 MD14G1087000.v1.1 MD16G1179200.v1.1 MD17G1030800.v1.1
prunus_persica Prupe.2G011000_v2.0.a1 Prupe.2G011000_v2.0.a1 Prupe.2G011000_v2.0.a1 Prupe.2G011000_v2.0.a1 Prupe.2G011000_v2.0.a1 Prupe.2G011000_v2.0.a1 Prupe.2G011400_v2.0.a1 Prupe.2G011500_v2.0.a1 Prupe.2G013800_v2.0.a1 Prupe.2G013800_v2.0.a1 Prupe.2G013800_v2.0.a1 Prupe.2G013900_v2.0.a1 Prupe.2G013900_v2.0.a1 Prupe.2G013900_v2.0.a1 Prupe.2G013900_v2.0.a1 Prupe.2G014000_v2.0.a1 Prupe.2G014100_v2.0.a1
pyrus_communis pycom02g25880 pycom07g00690 pycom07g00720 pycom07g01130 pycom07g01140 pycom07g01150 pycom07g01160 pycom07g01260 pycom07g01280 pycom07g01300 pycom07g01320 pycom07g01550 pycom07g01790 pycom07g01810 pycom07g01840 pycom07g01850 pycom07g01870 pycom07g01880 pycom07g01890 pycom13g15290 pycom16g15040
rosa_chinensis RchiOBHm_Chr4g0420141
rosa_multiflora Rmu_sc0001252.1_g000002
rosa_roxburghii Rroxscaffold_1G00012760
rosa_rugosa Rorug04G0162600
rosa_samantha Rh4AG223400 Rh4BG225900 Rh4CG236600 Rh4DG222200
rosa_wichuraiana Rw4G019230

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 761
Acc16I TGCGCA 1 cut(s) 119
AcsI RAATTY 3 cut(s) 31, 715, 865
AcvI CACGTG 1 cut(s) 899
AfaI GTAC 2 cut(s) 297, 700
AluBI AGCT 2 cut(s) 267, 550
AluI AGCT 2 cut(s) 267, 550
Alw21I GWGCWC 1 cut(s) 231
Alw26I GTCTC 2 cut(s) 746, 829
AoxI GGCC 1 cut(s) 321
ApoI RAATTY 3 cut(s) 31, 715, 865
ArsI GACNNNNNNTTYG 2 cut(s) 707, 739
Asp700I GAANNNNTTC 1 cut(s) 549
AspLEI GCGC 1 cut(s) 120
AspS9I GGNCC 1 cut(s) 322
AsuII TTCGAA 1 cut(s) 863
BbrPI CACGTG 1 cut(s) 899
Bbv12I GWGCWC 1 cut(s) 231
BccI CCATC 4 cut(s) 8, 49, 241, 823
BcoDI GTCTC 2 cut(s) 746, 829
BfaI CTAG 1 cut(s) 878
BglII AGATCT 1 cut(s) 880
BmgT120I GGNCC 1 cut(s) 322
BplI GAGNNNNNCTC 2 cut(s) 72, 104
Bpu14I TTCGAA 1 cut(s) 863
BsaAI YACGTR 2 cut(s) 559, 899
BsaJI CCNNGG 2 cut(s) 325, 609
BseDI CCNNGG 2 cut(s) 325, 609
BseGI GGATG 5 cut(s) 60, 117, 341, 373, 738
BsgI GTGCAG 1 cut(s) 421
BshFI GGCC 1 cut(s) 323
BsiHKAI GWGCWC 1 cut(s) 231
BsmAI GTCTC 2 cut(s) 746, 829
BsmI GAATGC 1 cut(s) 897
BsnI GGCC 1 cut(s) 323
Bsp119I TTCGAA 1 cut(s) 863
Bsp1286I GDGCHC 1 cut(s) 231
Bsp143I GATC 5 cut(s) 404, 466, 520, 808, 880
BspANI GGCC 1 cut(s) 323
BspHI TCATGA 4 cut(s) 130, 471, 541, 825
BspT104I TTCGAA 1 cut(s) 863
BssECI CCNNGG 2 cut(s) 325, 609
BssMI GATC 5 cut(s) 404, 466, 520, 808, 880
BssT1I CCWWGG 2 cut(s) 325, 609
BstBAI YACGTR 2 cut(s) 559, 899
BstBI TTCGAA 1 cut(s) 863
BstC8I GCNNGC 1 cut(s) 622
BstDEI CTNAG 4 cut(s) 95, 215, 490, 812
BstF5I GGATG 5 cut(s) 60, 117, 341, 373, 738
BstHHI GCGC 1 cut(s) 120
BstKTI GATC 5 cut(s) 407, 469, 523, 811, 883
BstMAI GTCTC 2 cut(s) 746, 829
BstMBI GATC 5 cut(s) 404, 466, 520, 808, 880
BstNSI RCATGY 1 cut(s) 624
BstX2I RGATCY 1 cut(s) 880
BstYI RGATCY 1 cut(s) 880
BsuRI GGCC 1 cut(s) 323
BtsCI GGATG 5 cut(s) 60, 117, 341, 373, 738
Cac8I GCNNGC 1 cut(s) 622
CciI TCATGA 4 cut(s) 130, 471, 541, 825
CfoI GCGC 1 cut(s) 120
Cfr13I GGNCC 1 cut(s) 322
CseI GACGC 1 cut(s) 499
Csp6I GTAC 2 cut(s) 296, 699
CviAII CATG 5 cut(s) 131, 472, 542, 621, 826
CviJI RGCY 5 cut(s) 5, 145, 267, 323, 550
CviKI_1 RGCY 5 cut(s) 5, 145, 267, 323, 550
CviQI GTAC 2 cut(s) 296, 699
DdeI CTNAG 4 cut(s) 95, 215, 490, 812
DpnI GATC 5 cut(s) 406, 468, 522, 810, 882
DpnII GATC 5 cut(s) 404, 466, 520, 808, 880
DraI TTTAAA 2 cut(s) 10, 781
Eco130I CCWWGG 2 cut(s) 325, 609
Eco32I GATATC 2 cut(s) 289, 803
Eco72I CACGTG 1 cut(s) 899
EcoRI GAATTC 1 cut(s) 31
EcoRV GATATC 2 cut(s) 289, 803
EcoT14I CCWWGG 2 cut(s) 325, 609
ErhI CCWWGG 2 cut(s) 325, 609
FaeI CATG 5 cut(s) 134, 475, 545, 624, 829
FatI CATG 5 cut(s) 130, 471, 541, 620, 825
FokI GGATG 5 cut(s) 67, 124, 328, 380, 745
FspBI CTAG 1 cut(s) 878
FspI TGCGCA 1 cut(s) 119
GlaI GCGC 1 cut(s) 119
HaeIII GGCC 1 cut(s) 323
HgaI GACGC 1 cut(s) 499
HhaI GCGC 1 cut(s) 120
Hin1II CATG 5 cut(s) 134, 475, 545, 624, 829
Hin6I GCGC 1 cut(s) 118
HinP1I GCGC 1 cut(s) 118
HindIII AAGCTT 1 cut(s) 548
HinfI GANTC 4 cut(s) 677, 689, 739, 820
Hpy188I TCNGA 2 cut(s) 346, 525
Hpy188III TCNNGA 8 cut(s) 131, 416, 472, 505, 542, 806, 826, 842
Hpy99I CGWCG 2 cut(s) 350, 515
HpyCH4IV ACGT 2 cut(s) 558, 898
HpyCH4V TGCA 4 cut(s) 402, 463, 485, 624
HpyF3I CTNAG 4 cut(s) 95, 215, 490, 812
HpySE526I ACGT 2 cut(s) 558, 898
Hsp92II CATG 5 cut(s) 134, 475, 545, 624, 829
HspAI GCGC 1 cut(s) 118
Kzo9I GATC 5 cut(s) 404, 466, 520, 808, 880
LmnI GCTCC 2 cut(s) 234, 507
LpnPI CCDG 5 cut(s) 39, 62, 291, 490, 855
MaeI CTAG 1 cut(s) 878
MaeII ACGT 2 cut(s) 558, 898
MaeIII GTNAC 2 cut(s) 554, 899
MalI GATC 5 cut(s) 406, 468, 522, 810, 882
MboI GATC 5 cut(s) 404, 466, 520, 808, 880
MboII GAAGA 3 cut(s) 32, 200, 431
MfeI CAATTG 1 cut(s) 705
MflI RGATCY 1 cut(s) 880
MhlI GDGCHC 1 cut(s) 231
MlyI GAGTC 2 cut(s) 686, 748
MmeI TCCRAC 2 cut(s) 369, 835
MnlI CCTC 3 cut(s) 52, 358, 649
MroXI GAANNNNTTC 1 cut(s) 549
MseI TTAA 7 cut(s) 9, 42, 147, 210, 336, 720, 780
MslI CAYNNNNRTG 1 cut(s) 890
MunI CAATTG 1 cut(s) 705
Mva1269I GAATGC 1 cut(s) 897
NdeII GATC 5 cut(s) 404, 466, 520, 808, 880
NlaIII CATG 5 cut(s) 134, 475, 545, 624, 829
NmuCI GTSAC 2 cut(s) 554, 899
NsbI TGCGCA 1 cut(s) 119
NspI RCATGY 1 cut(s) 624
NspV TTCGAA 1 cut(s) 863
PaeI GCATGC 1 cut(s) 624
PagI TCATGA 4 cut(s) 130, 471, 541, 825
PctI GAATGC 1 cut(s) 897
PdmI GAANNNNTTC 1 cut(s) 549
PfeI GAWTC 2 cut(s) 689, 820
PleI GAGTC 2 cut(s) 685, 747
PmaCI CACGTG 1 cut(s) 899
PmlI CACGTG 1 cut(s) 899
PpsI GAGTC 2 cut(s) 685, 747
Ppu21I YACGTR 2 cut(s) 559, 899
PsiI TTATAA 1 cut(s) 761
PspCI CACGTG 1 cut(s) 899
PspPI GGNCC 1 cut(s) 322
PsuI RGATCY 1 cut(s) 880
RsaI GTAC 2 cut(s) 297, 700
RsaNI GTAC 2 cut(s) 296, 699
RseI CAYNNNNRTG 1 cut(s) 890
SaqAI TTAA 7 cut(s) 9, 42, 147, 210, 336, 720, 780
Sau3AI GATC 5 cut(s) 404, 466, 520, 808, 880
Sau96I GGNCC 1 cut(s) 322
SchI GAGTC 2 cut(s) 686, 748
SduI GDGCHC 1 cut(s) 231
SetI ASST 8 cut(s) 63, 109, 269, 280, 552, 561, 660, 901
SfuI TTCGAA 1 cut(s) 863
SmiMI CAYNNNNRTG 1 cut(s) 890
SphI GCATGC 1 cut(s) 624
SspI AATATT 1 cut(s) 383
SspMI CTAG 1 cut(s) 878
StyI CCWWGG 2 cut(s) 325, 609
TaiI ACGT 2 cut(s) 561, 901
TaqI TCGA 2 cut(s) 354, 863
TfiI GAWTC 2 cut(s) 689, 820
Tru1I TTAA 7 cut(s) 9, 42, 147, 210, 336, 720, 780
Tru9I TTAA 7 cut(s) 9, 42, 147, 210, 336, 720, 780
TseFI GTSAC 2 cut(s) 554, 899
Tsp45I GTSAC 2 cut(s) 554, 899
TspDTI ATGAA 7 cut(s) 147, 488, 492, 530, 558, 681, 803
TspGWI ACGGA 1 cut(s) 745
XapI RAATTY 3 cut(s) 31, 715, 865
XceI RCATGY 1 cut(s) 624
XcmI CCANNNNNNNNNTGG 1 cut(s) 903
XmnI GAANNNNTTC 1 cut(s) 549
XspI CTAG 1 cut(s) 878
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.