pycom07g01880

Belongs to the disease resistance NB-LRR family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
OG0000725
Physical Location & Seq
Reverse (-)
1467319 .. 1468474
1156 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g01880.3

Sequence Viewer

Length: 1065 bp
ATGAAGATAAAAAGGCAATTATCCAACTTTTTTGGATTTGGAGGATTGGGGAAAACTGCACTTGCCCAACTCATATTCAACGATGAGGTGATTCAAAATCATTTTGAGTTGAAAATATGGACATGTGTCTCTAATGTATTTGAGTTGGATATAGTTGTTAAGAAAATCCTTCAATCCAAAAATCATGATGAGATTGAGCAGTTGCAAAATGATCTTAGGGAAAAAGTAGATGGGAAGAAGTACCTACTTGTGTTGGATGACGTGTGGAATGAGGATCGAGAGAAGTGGCTTAGCTTGAAGAACTTGTTAGTGGGCGGTGGAGAAGGTAGTAGAATACTAATAACCACTCGTAGTAAAACCGTTGCGACGATATCAGACACAGCTAAACCATACACCTTAAAGGGTTTGAATGAAGAGCAAAGTTGGTCTTTATTTAAGAAAATAGCTTATAAAGATGGAAAGGAGCCAGAGAATCCAACAATTAAGGCAGTTGGGGAGGAGGTTGCAAGAAAATGTCAAGGAGTTCCACTCGCTATAAGGACGATGGGTGGGATGTTGTTTGCCAATGATGACGAAACAAATTGGTTGAATTTCAAAGAAAAGACACTTTCAAAAATAAATCAAGAACAAAATGCTATTTTACCAACACTTAAATTGTGTTATGATGTGCTCCCATCACATTTGAAGCATTGTTTTGCTTATTGTAGTTTGTTCCCACCTGATTATGAGATCTCTGTACAGAGATTGATTAGACTTTGGGTGGCGCAAGGGTTCATTAAGTCATCCGACGAAAACGAGTGCTTAGAGGATGTTGCATATGAATATTACAAAGAGTTGTTGTGGAGATCGTTTTTTCAAGAAGAAGAAAAAGATGAGTTTGGTATAATAAGAAGTTGTAAAATGCACGATCTCATGAATGAACTTGCAATCTTAGTGTCGGGGGTTGGAAGCGTCGTAGTTGAACCAAACCAAAAGAATTTTCATGAAAAGCTTCATCATGTATCTTTCAATTTTCAAATTGATCCGTTGGAAAGGGAAGTGCCAACTTTGTTGCCAAAATGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04014 map04014
Pfam Domains
Protein Families
LRR_8 NB-ARC

Protein Analysis

355

Amino Acids

40.88

Weight (kDa)

5.74

Isoelectric Point (pI)

35.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000725)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g16700
malus_domestica MD02G1307600.v1.1 MD03G1278800.v1.1 MD03G1279100.v1.1 MD03G1279600.v1.1 MD03G1280000.v1.1 MD03G1280200.v1.1 MD07G1008400.v1.1 MD07G1014900.v1.1 MD07G1015700.v1.1 MD07G1016100.v1.1 MD07G1016200.v1.1 MD07G1016500.v1.1 MD07G1016600.v1.1 MD07G1016700.v1.1 MD07G1017400.v1.1 MD07G1019600.v1.1 MD07G1019800.v1.1 MD07G1023700.v1.1 MD07G1024100.v1.1 MD07G1024300.v1.1 MD07G1024400.v1.1 MD14G1086900.v1.1 MD14G1087000.v1.1 MD16G1179200.v1.1 MD17G1030800.v1.1
prunus_persica Prupe.2G011000_v2.0.a1 Prupe.2G011000_v2.0.a1 Prupe.2G011000_v2.0.a1 Prupe.2G011000_v2.0.a1 Prupe.2G011000_v2.0.a1 Prupe.2G011000_v2.0.a1 Prupe.2G011400_v2.0.a1 Prupe.2G011500_v2.0.a1 Prupe.2G013800_v2.0.a1 Prupe.2G013800_v2.0.a1 Prupe.2G013800_v2.0.a1 Prupe.2G013900_v2.0.a1 Prupe.2G013900_v2.0.a1 Prupe.2G013900_v2.0.a1 Prupe.2G013900_v2.0.a1 Prupe.2G014000_v2.0.a1 Prupe.2G014100_v2.0.a1
pyrus_communis pycom02g25880 pycom07g00690 pycom07g00720 pycom07g01130 pycom07g01140 pycom07g01150 pycom07g01160 pycom07g01260 pycom07g01280 pycom07g01300 pycom07g01320 pycom07g01550 pycom07g01790 pycom07g01810 pycom07g01840 pycom07g01850 pycom07g01870 pycom07g01880 pycom07g01890 pycom13g15290 pycom16g15040
rosa_chinensis RchiOBHm_Chr4g0420141
rosa_multiflora Rmu_sc0001252.1_g000002
rosa_roxburghii Rroxscaffold_1G00012760
rosa_rugosa Rorug04G0162600
rosa_samantha Rh4AG223400 Rh4BG225900 Rh4CG236600 Rh4DG222200
rosa_wichuraiana Rw4G019230

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 450
AciI CCGC 1 cut(s) 315
AclWI GGATC 2 cut(s) 282, 1016
AcsI RAATTY 2 cut(s) 589, 976
AfaI GTAC 2 cut(s) 242, 738
AflIII ACRYGT 2 cut(s) 122, 261
AjiI CACGTC 1 cut(s) 262
AjuI GAANNNNNNNTTGG 2 cut(s) 963, 995
AluBI AGCT 4 cut(s) 294, 383, 446, 991
AluI AGCT 4 cut(s) 294, 383, 446, 991
Alw21I GWGCWC 1 cut(s) 672
Alw26I GTCTC 1 cut(s) 133
AlwI GGATC 2 cut(s) 282, 1016
ApoI RAATTY 2 cut(s) 589, 976
Asp700I GAANNNNTTC 1 cut(s) 990
AspLEI GCGC 1 cut(s) 766
AsuHPI GGTGA 1 cut(s) 100
Bbv12I GWGCWC 1 cut(s) 672
BccI CCATC 4 cut(s) 224, 449, 538, 682
BcoDI GTCTC 1 cut(s) 133
BglII AGATCT 1 cut(s) 729
BlpI GCTNAGC 1 cut(s) 290
BmgBI CACGTC 1 cut(s) 262
BmiI GGNNCC 1 cut(s) 465
BoxI GACNNNNGTC 1 cut(s) 125
BplI GAGNNNNNCTC 2 cut(s) 513, 545
Bpu1102I GCTNAGC 1 cut(s) 290
BseGI GGATG 4 cut(s) 262, 558, 782, 814
BseRI GAGGAG 1 cut(s) 512
BsgI GTGCAG 1 cut(s) 42
BsiHKAI GWGCWC 1 cut(s) 672
BsmAI GTCTC 1 cut(s) 133
Bsp1286I GDGCHC 1 cut(s) 672
Bsp1407I TGTACA 1 cut(s) 736
Bsp143I GATC 6 cut(s) 211, 274, 729, 845, 907, 1021
Bsp1720I GCTNAGC 1 cut(s) 290
BspACI CCGC 1 cut(s) 315
BspHI TCATGA 3 cut(s) 184, 912, 982
BspLI GGNNCC 1 cut(s) 465
BspPI GGATC 2 cut(s) 282, 1016
BspQI GCTCTTC 1 cut(s) 408
BsrGI TGTACA 1 cut(s) 736
BssMI GATC 6 cut(s) 211, 274, 729, 845, 907, 1021
Bst4CI ACNGT 1 cut(s) 361
Bst6I CTCTTC 1 cut(s) 408
BstAUI TGTACA 1 cut(s) 736
BstDEI CTNAG 4 cut(s) 215, 290, 802, 931
BstF5I GGATG 4 cut(s) 262, 558, 782, 814
BstHHI GCGC 1 cut(s) 766
BstKTI GATC 6 cut(s) 214, 277, 732, 848, 910, 1024
BstMAI GTCTC 1 cut(s) 133
BstMBI GATC 6 cut(s) 211, 274, 729, 845, 907, 1021
BstNSI RCATGY 1 cut(s) 126
BstPAI GACNNNNGTC 1 cut(s) 125
BstX2I RGATCY 1 cut(s) 729
BstYI RGATCY 1 cut(s) 729
BtrI CACGTC 1 cut(s) 262
BtsCI GGATG 4 cut(s) 262, 558, 782, 814
CciI TCATGA 3 cut(s) 184, 912, 982
CfoI GCGC 1 cut(s) 766
CseI GACGC 1 cut(s) 940
Csp6I GTAC 2 cut(s) 241, 737
CviAII CATG 5 cut(s) 123, 185, 913, 983, 998
CviJI RGCY 6 cut(s) 289, 294, 383, 446, 466, 991
CviKI_1 RGCY 6 cut(s) 289, 294, 383, 446, 466, 991
CviQI GTAC 2 cut(s) 241, 737
DdeI CTNAG 4 cut(s) 215, 290, 802, 931
DpnI GATC 6 cut(s) 213, 276, 731, 847, 909, 1023
DpnII GATC 6 cut(s) 211, 274, 729, 845, 907, 1021
Eam1104I CTCTTC 1 cut(s) 408
EarI CTCTTC 1 cut(s) 408
Eco32I GATATC 1 cut(s) 372
EcoRV GATATC 1 cut(s) 372
FaeI CATG 5 cut(s) 126, 188, 916, 986, 1001
FalI AAGNNNNNCTT 2 cut(s) 412, 444
FatI CATG 5 cut(s) 122, 184, 912, 982, 997
FauNDI CATATG 1 cut(s) 817
FokI GGATG 4 cut(s) 269, 565, 769, 821
GlaI GCGC 1 cut(s) 765
HgaI GACGC 1 cut(s) 940
HhaI GCGC 1 cut(s) 766
Hin1II CATG 5 cut(s) 126, 188, 916, 986, 1001
Hin6I GCGC 1 cut(s) 764
HinP1I GCGC 1 cut(s) 764
HindIII AAGCTT 1 cut(s) 989
HinfI GANTC 2 cut(s) 91, 472
HphI GGTGA 1 cut(s) 100
Hpy188I TCNGA 2 cut(s) 376, 787
Hpy188III TCNNGA 6 cut(s) 185, 278, 623, 857, 913, 983
Hpy99I CGWCG 3 cut(s) 370, 791, 956
HpyAV CCTTC 2 cut(s) 179, 317
HpyCH4III ACNGT 1 cut(s) 361
HpyCH4IV ACGT 1 cut(s) 261
HpyCH4V TGCA 6 cut(s) 59, 205, 506, 815, 904, 926
HpyF3I CTNAG 4 cut(s) 215, 290, 802, 931
HpySE526I ACGT 1 cut(s) 261
Hsp92II CATG 5 cut(s) 126, 188, 916, 986, 1001
HspAI GCGC 1 cut(s) 764
Kzo9I GATC 6 cut(s) 211, 274, 729, 845, 907, 1021
LguI GCTCTTC 1 cut(s) 408
LmnI GCTCC 2 cut(s) 463, 675
LpnPI CCDG 2 cut(s) 480, 732
MaeII ACGT 1 cut(s) 261
MalI GATC 6 cut(s) 213, 276, 731, 847, 909, 1023
MboI GATC 6 cut(s) 211, 274, 729, 845, 907, 1021
MboII GAAGA 6 cut(s) 16, 247, 310, 425, 872, 875
MflI RGATCY 1 cut(s) 729
MhlI GDGCHC 1 cut(s) 672
MluCI AATT 8 cut(s) 17, 480, 580, 589, 653, 976, 1009, 1017
MmeI TCCRAC 7 cut(s) 48, 126, 234, 500, 810, 925, 1008
MnlI CCTC 6 cut(s) 35, 79, 265, 490, 493, 799
MroXI GAANNNNTTC 1 cut(s) 990
MseI TTAA 6 cut(s) 159, 398, 435, 483, 651, 777
NdeI CATATG 1 cut(s) 817
NdeII GATC 6 cut(s) 211, 274, 729, 845, 907, 1021
NlaIII CATG 5 cut(s) 126, 188, 916, 986, 1001
NlaIV GGNNCC 1 cut(s) 465
NspI RCATGY 1 cut(s) 126
PagI TCATGA 3 cut(s) 184, 912, 982
PciI ACATGT 1 cut(s) 122
PciSI GCTCTTC 1 cut(s) 408
PdmI GAANNNNTTC 1 cut(s) 990
PfeI GAWTC 2 cut(s) 91, 472
PscI ACATGT 1 cut(s) 122
PshAI GACNNNNGTC 1 cut(s) 125
PsiI TTATAA 1 cut(s) 450
PspN4I GGNNCC 1 cut(s) 465
PsuI RGATCY 1 cut(s) 729
RsaI GTAC 2 cut(s) 242, 738
RsaNI GTAC 2 cut(s) 241, 737
SapI GCTCTTC 1 cut(s) 408
SaqAI TTAA 6 cut(s) 159, 398, 435, 483, 651, 777
Sau3AI GATC 6 cut(s) 211, 274, 729, 845, 907, 1021
SduI GDGCHC 1 cut(s) 672
Sse9I AATT 8 cut(s) 17, 480, 580, 589, 653, 976, 1009, 1017
SsiI CCGC 1 cut(s) 315
SspI AATATT 1 cut(s) 824
TaaI ACNGT 1 cut(s) 361
TaiI ACGT 1 cut(s) 264
TaqI TCGA 1 cut(s) 277
TasI AATT 8 cut(s) 17, 480, 580, 589, 653, 976, 1009, 1017
TatI WGTACW 1 cut(s) 736
TfiI GAWTC 2 cut(s) 91, 472
Tru1I TTAA 6 cut(s) 159, 398, 435, 483, 651, 777
Tru9I TTAA 6 cut(s) 159, 398, 435, 483, 651, 777
TspDTI ATGAA 9 cut(s) 17, 426, 763, 834, 929, 933, 971, 983, 999
TspGWI ACGGA 1 cut(s) 1014
XapI RAATTY 2 cut(s) 589, 976
XceI RCATGY 1 cut(s) 126
XmnI GAANNNNTTC 1 cut(s) 990
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.